Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAMBPL1 cdna clone

STAMBPL1 cDNA Clone

Gene Names
STAMBPL1; AMSH-FP; AMSH-LP; ALMalpha; bA399O19.2
Synonyms
STAMBPL1; STAMBPL1 cDNA Clone; STAMBPL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgaccatacagatgtttccctaagcccagaagagcgagtccgtgccctaagcaagcttggttgtaatatcaccatcagtgaagacatcactccacgacgttactttaggtctggagtagagatggagaggatggcgtctgtgtatttggaagaaggaaatttggaaaatgcctttgttctttataataaatttataaccttatttgtagaaaagcttcctaaccatcgagattaccagcaatgtgcagtacctgaaaagcaggatattatgaagaaactgaaggagattgcattcccaaggacagatgaattgaaaaacgaccttttaaagaaatataacgtagaataccaagaatatttgcaaagcaaaaacaaatataaagctgaaattctcaaaaaattggagcatcagagattgatagaggcagaaaggaagcggattgctcagatgcgccagcagcagctagaatcggagcagtttctgtttttcgaagatcaactcaagaagcaagagttagcccgaggtcaaatgcgaagtcagcaaacctcagggctgtcagagcagattgatgggagcgctttgtcctgcttttccacacaccagaacaattccttgctgaatgtatttgcagatcaacctaataaaagtgatgcaaccaattatgctagccactctcctcctgtaaacagggccttaacaccagctgctactctaagtgctgttcagaatttagtggttgaaggactgcgatgtgtagttttgccagaagatctttgccacaaatttctgcaactggcagaatctaatacagtgagaggaatagaaacctgtggaatactctgtggaaaactgacacataatgaatttactattacccatgtaattgtgccaaagcagtctgcgggaccagactattgtgacatggagaatgtagaggaattattcaatgttcaggatcaacatgatctcctcactctaggatggatccatacacatcccactcaaactgcatttttatccagcgttgatcttcacactcactgttcctatcaactcatgttgccagaggccattgccattgtttgctcaccaaagcataaagacactggcatcttcaggctcaccaatgctggcatgcttgaggtttctgcttgtaaaaaaaagggctttcatccacacaccaaggagcccaggctgttcagtatatgcaaacatgtgttggtaaaagacataaaaataattgtgttggatctgaggtga
Sequence Length
1266
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,199 Da
NCBI Official Full Name
Homo sapiens STAM binding protein-like 1, mRNA
NCBI Official Synonym Full Names
STAM binding protein like 1
NCBI Official Symbol
STAMBPL1
NCBI Official Synonym Symbols
AMSH-FP; AMSH-LP; ALMalpha; bA399O19.2
NCBI Protein Information
AMSH-like protease
UniProt Protein Name
AMSH-like protease
Protein Family
UniProt Gene Name
STAMBPL1
UniProt Synonym Gene Names
AMSHLP; KIAA1373; AMSH-LP
UniProt Entry Name
STALP_HUMAN

Uniprot Description

STAMBPL1: Zinc metalloprotease that specifically cleaves 'Lys-63'- linked polyubiquitin chains. Does not cleave 'Lys-48'-linked polyubiquitin chains. Belongs to the peptidase M67C family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; EC 3.4.19.-; EC 3.1.2.15; Protease

Chromosomal Location of Human Ortholog: 10q23.31

Cellular Component: membrane

Molecular Function: protein binding

Research Articles on STAMBPL1

Similar Products

Product Notes

The STAMBPL1 stambpl1 (Catalog #AAA1275707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgacc atacagatgt ttccctaagc ccagaagagc gagtccgtgc cctaagcaag cttggttgta atatcaccat cagtgaagac atcactccac gacgttactt taggtctgga gtagagatgg agaggatggc gtctgtgtat ttggaagaag gaaatttgga aaatgccttt gttctttata ataaatttat aaccttattt gtagaaaagc ttcctaacca tcgagattac cagcaatgtg cagtacctga aaagcaggat attatgaaga aactgaagga gattgcattc ccaaggacag atgaattgaa aaacgacctt ttaaagaaat ataacgtaga ataccaagaa tatttgcaaa gcaaaaacaa atataaagct gaaattctca aaaaattgga gcatcagaga ttgatagagg cagaaaggaa gcggattgct cagatgcgcc agcagcagct agaatcggag cagtttctgt ttttcgaaga tcaactcaag aagcaagagt tagcccgagg tcaaatgcga agtcagcaaa cctcagggct gtcagagcag attgatggga gcgctttgtc ctgcttttcc acacaccaga acaattcctt gctgaatgta tttgcagatc aacctaataa aagtgatgca accaattatg ctagccactc tcctcctgta aacagggcct taacaccagc tgctactcta agtgctgttc agaatttagt ggttgaagga ctgcgatgtg tagttttgcc agaagatctt tgccacaaat ttctgcaact ggcagaatct aatacagtga gaggaataga aacctgtgga atactctgtg gaaaactgac acataatgaa tttactatta cccatgtaat tgtgccaaag cagtctgcgg gaccagacta ttgtgacatg gagaatgtag aggaattatt caatgttcag gatcaacatg atctcctcac tctaggatgg atccatacac atcccactca aactgcattt ttatccagcg ttgatcttca cactcactgt tcctatcaac tcatgttgcc agaggccatt gccattgttt gctcaccaaa gcataaagac actggcatct tcaggctcac caatgctggc atgcttgagg tttctgcttg taaaaaaaag ggctttcatc cacacaccaa ggagcccagg ctgttcagta tatgcaaaca tgtgttggta aaagacataa aaataattgt gttggatctg aggtga. It is sometimes possible for the material contained within the vial of "STAMBPL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.