Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAMBP cdna clone

STAMBP cDNA Clone

Gene Names
STAMBP; AMSH; MICCAP
Synonyms
STAMBP; STAMBP cDNA Clone; STAMBP cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgaccatggagatgtgagcctcccgcccgaagaccgggtgagggctctctcccagctgggtagtgcggtagaggtgaatgaagacattccaccccgtcggtacttccgctctggagttgagattatccgaatggcatccatttactctgaggaaggcaacattgaacatgccttcatcctctataacaagtatatcacgctctttattgagaaactaccaaaacatcgagattacaaatctgctgtcattcctgaaaagaaagacacagtaaagaaattaaaggagattgcatttcccaaagcagaagagctgaaggcagagctgttaaaacgatataccaaagaatatacagaatataatgaagaaaagaagaaggaagcagaggaattggcccggaacatggccatccagcaagagctggaaaaggaaaaacagagggtagcacaacagaagcagcagcaattggaacaggaacagttccatgccttcgaggagatgatccggaaccaggagctagaaaaagagcgactgaaaattgtacaggagtttgggaaggtagaccctggcctaggtggcccgctagtgcctgacttggagaagccctccttagatgtgttccccaccttaacagtctcatccatacagccttcagactgtcacacaactgtaaggccagctaagccacctgtggtggacaggtccttgaaacctggagcactgagcaactcagaaagtattcccacaatcgatggattgcgccatgtggtggtgcctgggcggctgtgcccacagtttctccagttagccagtgccaacactgcccggggagtggagacatgtggaattctctgtggaaaactgatgaggaatgaatttaccattacccatgttctcatccccaagcaaagtgctgggtctgattactgcaacacagagaacgaagaagaacttttcctcatacaggatcagcagggcctcatcacactgggctggattcatactcaccccacacagaccgcgtttctctccagtgtcgacctacacactcactgctcttaccagatgatgttgccagagtcagtagccattgtttgctcccccaagttccaggaaactggattctttaaactaactgaccatggactagaggagatttcttcctgtcgccagaaaggatttcatccacacagcaaggatccacctctgttctgtagctgcagccacgtgactgttgtggacagagcagtgaccatcacagaccttcgatga
Sequence Length
1275
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,596 Da
NCBI Official Full Name
Homo sapiens STAM binding protein, mRNA
NCBI Official Synonym Full Names
STAM binding protein
NCBI Official Symbol
STAMBP
NCBI Official Synonym Symbols
AMSH; MICCAP
NCBI Protein Information
STAM-binding protein
UniProt Protein Name
STAM-binding protein
Protein Family
UniProt Gene Name
STAMBP
UniProt Synonym Gene Names
AMSH
UniProt Entry Name
STABP_HUMAN

NCBI Description

Cytokine-mediated signal transduction in the JAK-STAT cascade requires the involvement of adaptor molecules. One such signal-transducing adaptor molecule contains an SH3 domain that is required for induction of MYC and cell growth. The protein encoded by this gene binds to the SH3 domain of the signal-transducing adaptor molecule, and plays a critical role in cytokine-mediated signaling for MYC induction and cell cycle progression. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

AMSH: an adaptor protein involved in cytokine signal transduction the JAK-STAT cascade. Binds to the SH3 domain of the signal-transducing adaptor molecule STAM (signal transducing adaptor molecule). May play a critical role in cytokine-mediated signaling for MYC induction and cell cycle progression.

Protein type: EC 3.4.19.-; EC 3.1.2.15; Ubiquitin-specific protease; Protease

Chromosomal Location of Human Ortholog: 2p13.1

Cellular Component: cleavage furrow; cytoplasm; nucleoplasm; nucleus; plasma membrane

Molecular Function: protein binding; protein domain specific binding; ubiquitin-specific protease activity

Biological Process: cytokinesis after mitosis; JAK-STAT cascade; negative regulation of phosphoinositide 3-kinase cascade; negative regulation of Ras protein signal transduction; positive regulation of cell proliferation; protein deubiquitination

Disease: Microcephaly-capillary Malformation Syndrome

Research Articles on STAMBP

Similar Products

Product Notes

The STAMBP stambp (Catalog #AAA1266101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgacc atggagatgt gagcctcccg cccgaagacc gggtgagggc tctctcccag ctgggtagtg cggtagaggt gaatgaagac attccacccc gtcggtactt ccgctctgga gttgagatta tccgaatggc atccatttac tctgaggaag gcaacattga acatgccttc atcctctata acaagtatat cacgctcttt attgagaaac taccaaaaca tcgagattac aaatctgctg tcattcctga aaagaaagac acagtaaaga aattaaagga gattgcattt cccaaagcag aagagctgaa ggcagagctg ttaaaacgat ataccaaaga atatacagaa tataatgaag aaaagaagaa ggaagcagag gaattggccc ggaacatggc catccagcaa gagctggaaa aggaaaaaca gagggtagca caacagaagc agcagcaatt ggaacaggaa cagttccatg ccttcgagga gatgatccgg aaccaggagc tagaaaaaga gcgactgaaa attgtacagg agtttgggaa ggtagaccct ggcctaggtg gcccgctagt gcctgacttg gagaagccct ccttagatgt gttccccacc ttaacagtct catccataca gccttcagac tgtcacacaa ctgtaaggcc agctaagcca cctgtggtgg acaggtcctt gaaacctgga gcactgagca actcagaaag tattcccaca atcgatggat tgcgccatgt ggtggtgcct gggcggctgt gcccacagtt tctccagtta gccagtgcca acactgcccg gggagtggag acatgtggaa ttctctgtgg aaaactgatg aggaatgaat ttaccattac ccatgttctc atccccaagc aaagtgctgg gtctgattac tgcaacacag agaacgaaga agaacttttc ctcatacagg atcagcaggg cctcatcaca ctgggctgga ttcatactca ccccacacag accgcgtttc tctccagtgt cgacctacac actcactgct cttaccagat gatgttgcca gagtcagtag ccattgtttg ctcccccaag ttccaggaaa ctggattctt taaactaact gaccatggac tagaggagat ttcttcctgt cgccagaaag gatttcatcc acacagcaag gatccacctc tgttctgtag ctgcagccac gtgactgttg tggacagagc agtgaccatc acagaccttc gatga. It is sometimes possible for the material contained within the vial of "STAMBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.