Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAC cdna clone

STAC cDNA Clone

Gene Names
STAC; STAC1
Synonyms
STAC; STAC cDNA Clone; STAC cdna clone
Ordering
For Research Use Only!
Sequence
atgatccctccgagcagcccccgcgaggacggcgtggacgggctgcccaaggaggcggtgggcgccgagcaaccgccctctcctgcatccaccagcagccaggaatccaagctccagaaactaaaacgatcactttctttcaagaccaagagtttacggagcaaaagtgctgacaacttcttccagcgaaccaacagcgaagacatgaaactgcaagcacacatggtggctgagatcagccccagctccagcccactccctgctccaggaagcctgacgtccacacccgccagggctggtctgcatccaggtggcaaggctcatgcctttcatgaatacatcttcaagaagcccactttctgtgatgtctgcaaccacatgatagtgggaacaaatgctaagcatggactgcgctgcaaagcctgtaagatgagcatccaccacaagtgcacagatggcctggcaccccagcggtgcatgggcaagctgccaaaggggtttcggcgttactacagctcccccttgctcattcatgaacagtttggctgcattaaagaagttatgcccattgcctgtggcaataaggtggaccctgtctacgagaccctccgcttcggcacctccctggcccagaggacaaagaagggcagctccggcagtggctctgactcacctcacagaacctctacttcagatcttgtggaggttcctgaggaagccaatgggccaggaggcgggtatgacctaaggaaacgcagcaacagcgtgtttacatatccagaaaatggcactgatgatttcagagatccagcgaagaacataaaccaccagggatctctttccaaagacccattacagatgaacacctatgttgccttgtacaaatttgtaccacaggagaatgaagatttggaaatgaggccaggagacataattactcttttagaggattccaatgaagactggtggaaagggaaaattcaagacagaattggcttctttccagccaactttgttcagagactacaacaaaatgagaagatttttagatgtgttagaaccttcattgggtgtaaggaacaggggcagataacactgaaagagaatcagatctgcgtgagttctgaagaagaacaagatggttttatcagagtcctcagtggaaaaaagaaaggcctcatcccccttgatgtactagaaaacatctga
Sequence Length
1209
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,554 Da
NCBI Official Full Name
Homo sapiens SH3 and cysteine rich domain, mRNA
NCBI Official Synonym Full Names
SH3 and cysteine rich domain
NCBI Official Symbol
STAC
NCBI Official Synonym Symbols
STAC1
NCBI Protein Information
SH3 and cysteine-rich domain-containing protein
UniProt Protein Name
SH3 and cysteine-rich domain-containing protein
Protein Family
UniProt Gene Name
STAC
UniProt Entry Name
STAC_HUMAN

Uniprot Description

STAC: Probably involved in a neuron-specific signal transduction.

Protein type: Lipid-binding

Chromosomal Location of Human Ortholog: 3p22.3

Molecular Function: protein binding

Similar Products

Product Notes

The STAC stac (Catalog #AAA1271180) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccctc cgagcagccc ccgcgaggac ggcgtggacg ggctgcccaa ggaggcggtg ggcgccgagc aaccgccctc tcctgcatcc accagcagcc aggaatccaa gctccagaaa ctaaaacgat cactttcttt caagaccaag agtttacgga gcaaaagtgc tgacaacttc ttccagcgaa ccaacagcga agacatgaaa ctgcaagcac acatggtggc tgagatcagc cccagctcca gcccactccc tgctccagga agcctgacgt ccacacccgc cagggctggt ctgcatccag gtggcaaggc tcatgccttt catgaataca tcttcaagaa gcccactttc tgtgatgtct gcaaccacat gatagtggga acaaatgcta agcatggact gcgctgcaaa gcctgtaaga tgagcatcca ccacaagtgc acagatggcc tggcacccca gcggtgcatg ggcaagctgc caaaggggtt tcggcgttac tacagctccc ccttgctcat tcatgaacag tttggctgca ttaaagaagt tatgcccatt gcctgtggca ataaggtgga ccctgtctac gagaccctcc gcttcggcac ctccctggcc cagaggacaa agaagggcag ctccggcagt ggctctgact cacctcacag aacctctact tcagatcttg tggaggttcc tgaggaagcc aatgggccag gaggcgggta tgacctaagg aaacgcagca acagcgtgtt tacatatcca gaaaatggca ctgatgattt cagagatcca gcgaagaaca taaaccacca gggatctctt tccaaagacc cattacagat gaacacctat gttgccttgt acaaatttgt accacaggag aatgaagatt tggaaatgag gccaggagac ataattactc ttttagagga ttccaatgaa gactggtgga aagggaaaat tcaagacaga attggcttct ttccagccaa ctttgttcag agactacaac aaaatgagaa gatttttaga tgtgttagaa ccttcattgg gtgtaaggaa caggggcaga taacactgaa agagaatcag atctgcgtga gttctgaaga agaacaagat ggttttatca gagtcctcag tggaaaaaag aaaggcctca tcccccttga tgtactagaa aacatctga. It is sometimes possible for the material contained within the vial of "STAC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.