Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ST3GAL4 cdna clone

ST3GAL4 cDNA Clone

Gene Names
ST3GAL4; STZ; SAT3; CGS23; SIAT4; NANTA3; SIAT4C; ST3GalIV
Synonyms
ST3GAL4; ST3GAL4 cDNA Clone; ST3GAL4 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcagcaagtcccgctggaagctcctggccatgttggctctggtcctggtcgtcatggtgtggtattccatctcccgggaagacaggtacatcgagcttttttattttcccatcccagagaagaaggagccgtgcctccagggtgaggcagagagcaaggcctctaagctctttggcaactactcccgggatcagcccatcttcctgcggcttgaggattatttctgggtcaagacgccatctgcttacgagctgccctatgggaccaaggggagtgaggatctgctcctccgggtgctagccatcaccagctcctccatccccaagaacatccagagcctcaggtgccgccgctgtgtggtcgtggggaacgggcaccggctgcggaacagctcactgggagatgccatcaacaagtacgatgtggtcatcagattgaacaatgccccagtggctggctatgagggtgacgtgggctccaagaccaccatgcgtctcttctaccctgaatctgcccacttcgaccccaaagtagaaaacaacccagacacactcctcgtcctggtagctttcaaggcaatggacttccactggattgagaccatcctgagtgataagaagcgggtgcgaaagggtttctggaaacagcctcccctcatctgggatgtcaatcctaaacagattcggattctcaaccccttcttcatggagattgcagctgacaaactgctgagcctgccaatgcaacagccacggaagattaagcagaagcccaccacgggcctgttggccatcacgctggccctccacctctgtgacttggtgcacattgccggctttggctacccagacgcctacaacaagaagcagaccattcactactatgagcagatcacgctcaagtccatggcggggtcaggccataatgtctcccaagaggccctggccattaagcggatgctggagatgggagctatcaagaacctcacgtccttctga
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,157 Da
NCBI Official Full Name
Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 4, mRNA
NCBI Official Synonym Full Names
ST3 beta-galactoside alpha-2,3-sialyltransferase 4
NCBI Official Symbol
ST3GAL4
NCBI Official Synonym Symbols
STZ; SAT3; CGS23; SIAT4; NANTA3; SIAT4C; ST3GalIV
NCBI Protein Information
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 4
UniProt Protein Name
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 4
UniProt Gene Name
ST3GAL4
UniProt Synonym Gene Names
CGS23; NANTA3; SIAT4C; STZ; Alpha 2,3-ST 4; Beta-galactoside alpha-2,3-sialyltransferase 4; ST3GalIV; SIAT4-C
UniProt Entry Name
SIA4C_HUMAN

NCBI Description

This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

ST3GAL4: It may catalyze the formation of the NeuAc-alpha-2,3- Gal-beta-1,3-GalNAc- or NeuAc-alpha-2,3-Gal-beta-1,3-GlcNAc- sequences found in terminal carbohydrate groups of glycoproteins and glycolipids. It may be involved in the biosynthesis of the sialyl Lewis X determinant. Also acts on the corresponding 1,3- galactosyl derivative. Belongs to the glycosyltransferase 29 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Glycan Metabolism - keratan sulfate biosynthesis; Glycan Metabolism - glycosphingolipid biosynthesis - lacto and neolacto series; EC 2.4.99.-; Transferase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: Golgi membrane; membrane

Molecular Function: beta-galactoside alpha-2,3-sialyltransferase activity; monosialoganglioside sialyltransferase activity

Biological Process: cognition; ganglioside biosynthetic process; keratan sulfate biosynthetic process; O-glycan processing; oligosaccharide metabolic process; protein amino acid N-linked glycosylation via asparagine

Research Articles on ST3GAL4

Similar Products

Product Notes

The ST3GAL4 st3gal4 (Catalog #AAA1272647) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcagca agtcccgctg gaagctcctg gccatgttgg ctctggtcct ggtcgtcatg gtgtggtatt ccatctcccg ggaagacagg tacatcgagc ttttttattt tcccatccca gagaagaagg agccgtgcct ccagggtgag gcagagagca aggcctctaa gctctttggc aactactccc gggatcagcc catcttcctg cggcttgagg attatttctg ggtcaagacg ccatctgctt acgagctgcc ctatgggacc aaggggagtg aggatctgct cctccgggtg ctagccatca ccagctcctc catccccaag aacatccaga gcctcaggtg ccgccgctgt gtggtcgtgg ggaacgggca ccggctgcgg aacagctcac tgggagatgc catcaacaag tacgatgtgg tcatcagatt gaacaatgcc ccagtggctg gctatgaggg tgacgtgggc tccaagacca ccatgcgtct cttctaccct gaatctgccc acttcgaccc caaagtagaa aacaacccag acacactcct cgtcctggta gctttcaagg caatggactt ccactggatt gagaccatcc tgagtgataa gaagcgggtg cgaaagggtt tctggaaaca gcctcccctc atctgggatg tcaatcctaa acagattcgg attctcaacc ccttcttcat ggagattgca gctgacaaac tgctgagcct gccaatgcaa cagccacgga agattaagca gaagcccacc acgggcctgt tggccatcac gctggccctc cacctctgtg acttggtgca cattgccggc tttggctacc cagacgccta caacaagaag cagaccattc actactatga gcagatcacg ctcaagtcca tggcggggtc aggccataat gtctcccaag aggccctggc cattaagcgg atgctggaga tgggagctat caagaacctc acgtccttct ga. It is sometimes possible for the material contained within the vial of "ST3GAL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.