Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSTR1 cdna clone

SSTR1 cDNA Clone

Gene Names
SSTR1; SS1R; SS1-R; SRIF-2; SS-1-R
Synonyms
SSTR1; SSTR1 cDNA Clone; SSTR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttccccaatggcaccgcctcctctccttcctcctctcctagccccagcccgggcagctgcggcgaaggcggcggcagcaggggccccggggccggcgctgcggacggcatggaggagccagggcgaaatgcgtcccagaacgggaccttgagcgagggccagggcagcgccatcctgatctctttcatctactccgtggtgtgcctggtggggctgtgtgggaactctatggtcatctacgtgatcctgcgctatgccaagatgaagacggccaccaacatctacatcctaaatctggccattgctgatgagctgctcatgctcagcgtgcccttcctagtcacctccacgttgttgcgccactggcccttcggtgcgctgctctgccgcctcgtgctcagcgtggacgcggtcaacatgttcaccagcatctactgtctgactgtgctcagcgtggaccgctacgtggccgtggtgcatcccatcaaggcggcccgctaccgccggcccaccgtggccaaggtagtaaacctgggcgtgtgggtgctatcgctgctcgtcatcctgcccatcgtggtcttctctcgcaccgcggccaacagcgacggcacggtggcttgcaacatgctcatgccagagcccgctcaacgctggctggtgggcttcgtgttgtacacatttctcatgggcttcctgctgcccgtgggggctatctgcctgtgctacgtgctcatcattgctaagatgcgcatggtggccctcaaggccggctggcagcagcgcaagcgctcggagcgcaagatcaccttaatggtgatgatggtggtgatggtgtttgtcatctgctggatgcctttctacgtggtgcagctggtcaacgtgtttgctgagcaggacgacgccacggtgagtcagctgtcggtcatcctcggctatgccaacagctgcgccaaccccatcctctatggctttctctcagacaacttcaagcgctctttccaacgcatcctatgcctcagctggatggacaacgccgcggaggagccggttgactattacgccaccgcgctcaagagccgtgcctacagtgtggaagacttccaacctgagaacctggagtccggcggcgtcttccgtaatggcacctgcacgtcccggatcacgacgctctga
Sequence Length
1176
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,686 Da
NCBI Official Full Name
Homo sapiens somatostatin receptor 1, mRNA
NCBI Official Synonym Full Names
somatostatin receptor 1
NCBI Official Symbol
SSTR1
NCBI Official Synonym Symbols
SS1R; SS1-R; SRIF-2; SS-1-R
NCBI Protein Information
somatostatin receptor type 1
UniProt Protein Name
Somatostatin receptor type 1
Protein Family
UniProt Gene Name
SSTR1
UniProt Synonym Gene Names
SS-1-R; SS1-R; SS1R
UniProt Entry Name
SSR1_HUMAN

NCBI Description

Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]

Uniprot Description

SSTR1: Receptor for somatostatin with higher affinity for somatostatin-14 than -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and Na(+)/H(+) exchanger via pertussis toxin insensitive G proteins. Belongs to the G-protein coupled receptor 1 family. Interacts with SKB1.

Protein type: Receptor, GPCR; GPCR, family 1; Cell cycle regulation; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q13

Cellular Component: integral to plasma membrane; neuron projection; plasma membrane

Molecular Function: neuropeptide binding; somatostatin receptor activity

Biological Process: cell surface receptor linked signal transduction; cell-cell signaling; digestion; G-protein signaling, coupled to cyclic nucleotide second messenger; negative regulation of cell proliferation; response to nutrient; synaptic transmission

Research Articles on SSTR1

Similar Products

Product Notes

The SSTR1 sstr1 (Catalog #AAA1266996) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcccca atggcaccgc ctcctctcct tcctcctctc ctagccccag cccgggcagc tgcggcgaag gcggcggcag caggggcccc ggggccggcg ctgcggacgg catggaggag ccagggcgaa atgcgtccca gaacgggacc ttgagcgagg gccagggcag cgccatcctg atctctttca tctactccgt ggtgtgcctg gtggggctgt gtgggaactc tatggtcatc tacgtgatcc tgcgctatgc caagatgaag acggccacca acatctacat cctaaatctg gccattgctg atgagctgct catgctcagc gtgcccttcc tagtcacctc cacgttgttg cgccactggc ccttcggtgc gctgctctgc cgcctcgtgc tcagcgtgga cgcggtcaac atgttcacca gcatctactg tctgactgtg ctcagcgtgg accgctacgt ggccgtggtg catcccatca aggcggcccg ctaccgccgg cccaccgtgg ccaaggtagt aaacctgggc gtgtgggtgc tatcgctgct cgtcatcctg cccatcgtgg tcttctctcg caccgcggcc aacagcgacg gcacggtggc ttgcaacatg ctcatgccag agcccgctca acgctggctg gtgggcttcg tgttgtacac atttctcatg ggcttcctgc tgcccgtggg ggctatctgc ctgtgctacg tgctcatcat tgctaagatg cgcatggtgg ccctcaaggc cggctggcag cagcgcaagc gctcggagcg caagatcacc ttaatggtga tgatggtggt gatggtgttt gtcatctgct ggatgccttt ctacgtggtg cagctggtca acgtgtttgc tgagcaggac gacgccacgg tgagtcagct gtcggtcatc ctcggctatg ccaacagctg cgccaacccc atcctctatg gctttctctc agacaacttc aagcgctctt tccaacgcat cctatgcctc agctggatgg acaacgccgc ggaggagccg gttgactatt acgccaccgc gctcaagagc cgtgcctaca gtgtggaaga cttccaacct gagaacctgg agtccggcgg cgtcttccgt aatggcacct gcacgtcccg gatcacgacg ctctga. It is sometimes possible for the material contained within the vial of "SSTR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.