SSBP3 cdna clone
SSBP3 cDNA Clone
Gene Names
SSBP3; CSDP; SSDP; SSDP1
Synonyms
SSBP3; SSBP3 cDNA Clone; SSBP3 cdna clone
Sequence
atgtttgccaaaggcaaaggctcggcggtgccctcggatgggcaggctcgggaaaagttagctttatacgtctacgaatatttactgcacgtaggagcacagaaatctgcacagaccttcttatcggagattcgatgggaaaaaaacatcacgttgggagaaccgcctgggtttttgcactcgtggtggtgtgtattttgggacctttactgtgcagctcctgaaaggagagacacttgtgaacattcaagtgaagcaaaagcctttcatgattatagtgcagcagctgccccgagccccgtgcttggcaacattccccccaacgatgggatgccgggaggccccatcccgccaggtttctttcagggtcctccggggtcacagccctcgccgcacgcacagcctccacctcacaatcctagcagcatgatgggaccccacagtcagccttttatgtcaccgcgatacgcaggcggccccaggcccccgatcagaatgggaaaccagcctccgggaggagttcctgggacacagccattgctgcccaattctatggatcccacacgacaacaaggccaccccaacatgggaggatcaatgcagagaatgaaccctccccgaggcatggggcccatgggtcccggcccacagaattacggcagcggcatgagaccaccacccaactccctcggccccgccatgcccgggattaacatgggcccgggagctggcagaccctggcccaatcctaacagtgctaactcaattccatactcctcctcatcacctggtacctatgtgggaccccctggtggtggcggtcctccaggaacacccattatgcccagtcccgcagattcaacaaattccagtgacaacatctacacaatgattaatccagtgccgcctggaggcagccggtccaacttcccgatgggtcccggctcggacggtccgatgggcggcatgggtggcatggagccacaccacatgaatggatcattagggtcaggcgacatagacggacttccaaaaaattctcctaacaacataagtggcattagcaatcctccaggcacccctcgagatgacggcgagctaggagggaacttcctccactcctttcagaacgacaattattctccaagcatgacgatgagtgtgtga
Sequence Length
1167
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,210 Da
NCBI Official Full Name
Homo sapiens single stranded DNA binding protein 3, mRNA
NCBI Official Synonym Full Names
single stranded DNA binding protein 3
NCBI Official Symbol
SSBP3
NCBI Official Synonym Symbols
CSDP; SSDP; SSDP1
NCBI Protein Information
single-stranded DNA-binding protein 3
UniProt Protein Name
Single-stranded DNA-binding protein 3
Protein Family
UniProt Gene Name
SSBP3
UniProt Synonym Gene Names
SSDP; SSDP1
UniProt Entry Name
SSBP3_HUMAN
Uniprot Description
SSBP3: May be involved in transcription regulation of the alpha 2(I) collagen gene where it binds to the single-stranded polypyrimidine sequences in the promoter region. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription regulation; Cell cycle regulation; DNA-binding
Chromosomal Location of Human Ortholog: 1p32.3
Molecular Function: protein binding
Research Articles on SSBP3
Similar Products
Product Notes
The SSBP3 ssbp3 (Catalog #AAA1276513) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttgcca aaggcaaagg ctcggcggtg ccctcggatg ggcaggctcg ggaaaagtta gctttatacg tctacgaata tttactgcac gtaggagcac agaaatctgc acagaccttc ttatcggaga ttcgatggga aaaaaacatc acgttgggag aaccgcctgg gtttttgcac tcgtggtggt gtgtattttg ggacctttac tgtgcagctc ctgaaaggag agacacttgt gaacattcaa gtgaagcaaa agcctttcat gattatagtg cagcagctgc cccgagcccc gtgcttggca acattccccc caacgatggg atgccgggag gccccatccc gccaggtttc tttcagggtc ctccggggtc acagccctcg ccgcacgcac agcctccacc tcacaatcct agcagcatga tgggacccca cagtcagcct tttatgtcac cgcgatacgc aggcggcccc aggcccccga tcagaatggg aaaccagcct ccgggaggag ttcctgggac acagccattg ctgcccaatt ctatggatcc cacacgacaa caaggccacc ccaacatggg aggatcaatg cagagaatga accctccccg aggcatgggg cccatgggtc ccggcccaca gaattacggc agcggcatga gaccaccacc caactccctc ggccccgcca tgcccgggat taacatgggc ccgggagctg gcagaccctg gcccaatcct aacagtgcta actcaattcc atactcctcc tcatcacctg gtacctatgt gggaccccct ggtggtggcg gtcctccagg aacacccatt atgcccagtc ccgcagattc aacaaattcc agtgacaaca tctacacaat gattaatcca gtgccgcctg gaggcagccg gtccaacttc ccgatgggtc ccggctcgga cggtccgatg ggcggcatgg gtggcatgga gccacaccac atgaatggat cattagggtc aggcgacata gacggacttc caaaaaattc tcctaacaac ataagtggca ttagcaatcc tccaggcacc cctcgagatg acggcgagct aggagggaac ttcctccact cctttcagaa cgacaattat tctccaagca tgacgatgag tgtgtga. It is sometimes possible for the material contained within the vial of "SSBP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
