Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSBP1 cdna clone

SSBP1 cDNA Clone

Gene Names
SSBP1; SSBP; mtSSB; Mt-SSB; SOSS-B1
Synonyms
SSBP1; SSBP1 cDNA Clone; SSBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttcgaagacctgtattacaggtacttcgtcagtttgtaagacatgagtccgaaacaactaccagtttggttcttgaaagatccctgaatcgtgtgcacttacttgggcgagtgggtcaggaccctgtcttgagacaggtggaaggaaaaaatccagtcacaatattttctctagcaactaatgagatgtggcgatcaggggatagtgaagtttaccaactgggtgatgtcagtcaaaagacaacatggcacagaatatcagtattccggccaggcctcagagacgtggcatatcaatatgtgaaaaaggggtctcgaatttatttggaagggaaaatagactatggtgaatacatggataaaaataatgtgaggcgacaagcaacaacaatcatagctgataatattatatttctgagtgaccagacgaaagagaaggagtag
Sequence Length
447
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,260 Da
NCBI Official Full Name
Homo sapiens single-stranded DNA binding protein 1, mRNA
NCBI Official Synonym Full Names
single stranded DNA binding protein 1
NCBI Official Symbol
SSBP1
NCBI Official Synonym Symbols
SSBP; mtSSB; Mt-SSB; SOSS-B1
NCBI Protein Information
single-stranded DNA-binding protein, mitochondrial
UniProt Protein Name
Single-stranded DNA-binding protein, mitochondrial
UniProt Gene Name
SSBP1
UniProt Synonym Gene Names
SSBP; Mt-SSB; MtSSB
UniProt Entry Name
SSBP_HUMAN

NCBI Description

SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]). It is also a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501].[supplied by OMIM, Feb 2010]

Uniprot Description

SSBP1: This protein binds preferentially and cooperatively to ss-DNA. Probably involved in mitochondrial DNA replication. Associates with mitochondrial DNA.

Protein type: Mitochondrial; RNA-binding

Chromosomal Location of Human Ortholog: 7q34

Cellular Component: mitochondrial matrix; mitochondrion; nucleus

Molecular Function: chromatin binding; protein binding

Biological Process: mitochondrion organization and biogenesis; positive regulation of helicase activity

Research Articles on SSBP1

Similar Products

Product Notes

The SSBP1 ssbp1 (Catalog #AAA1269037) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcgaa gacctgtatt acaggtactt cgtcagtttg taagacatga gtccgaaaca actaccagtt tggttcttga aagatccctg aatcgtgtgc acttacttgg gcgagtgggt caggaccctg tcttgagaca ggtggaagga aaaaatccag tcacaatatt ttctctagca actaatgaga tgtggcgatc aggggatagt gaagtttacc aactgggtga tgtcagtcaa aagacaacat ggcacagaat atcagtattc cggccaggcc tcagagacgt ggcatatcaa tatgtgaaaa aggggtctcg aatttatttg gaagggaaaa tagactatgg tgaatacatg gataaaaata atgtgaggcg acaagcaaca acaatcatag ctgataatat tatatttctg agtgaccaga cgaaagagaa ggagtag. It is sometimes possible for the material contained within the vial of "SSBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.