SRP54 cdna clone
SRP54 cDNA Clone
Synonyms
SRP54; SRP54 cDNA Clone; SRP54 cdna clone
Sequence
atggttctagcagaccttggaagaaaaataacatcagcattacgctcgttgagcaatgccaccattatcaatgaagaggtattgaatgctatgctaaaagaagtctgtaccgctttgttggaagcagatgttaatattaaactagtgaagcaactaagagaaaatgttaagtctgctattgatcttgaagagatggcatctggtcttaacaaaagaaaaatgattcagcatgctgtatttaaagaacttgtgaagcttgtagaccctggagttaaggcatggacacccactaaaggaaaacaaaatgtgattatgtttgttggattgcaagggagtggtaaaacaacaacatgttcaaagctagcatattattaccagaggaaaggttggaagacctgtttaatatgtgcagacacattcagagcaggggcttttgaccaactaaaacagaatgctaccaaagcaagaattccattttatggaagctatacagaaatggatcctgtcatcattgcttctgaaggagtagagaaatttaaaaatgaaaattttgaaattattattgttgatacaagtggccgccacaaacaagaagactctttgtttgaagaaatgcttcaagttgctaatgctatacaacctgataacattgtttatgtgatggatgcctccattgggcaggcttgtgaagcccaggctaaggcttttaaagataaagtagatgtagcctcagtaatagtgacaaaacttgatggccatgcaaaaggaggtggtgcactcagtgcagtcgctgccacaaaaagtccgattattttcattggtacaggggaacatatagatgactttgaacctttcaaaacacagccttttattagcaaacttcttggtatgggcgacattgaaggactgatagataaagtcaacgagttgaagttggatgacaatgaagcacttatagagaagttgaaacatggtcagtttacgttgcgagacatgtatgagcaatttcaaaatatcatgaaaatgggccccttcagtcagatcttggggatgatccctggttttgggacagattttatgagcaaaggaaatgaacaggagtcaatggcaaggctaaagaaattaatgacaataatggatagtatgaatgatcaagaactagacagtacggatggtgccaaagtttttagtaaacaaccaggaagaatccaaagagtagcaagaggatcgggtgtatcaacaagagatgttcaagaacttttgacacaatataccaagtttgcacagatggtaaaaaagatgggaggtatcaaaggacttttcaaaggtggcgacatgtctaagaatgtgagccagtcacagatggcaaaattgaaccaacaaatggccaaaatgatggatcctagggttcttcatcacatgggtggtatggcaggacttcagtcaatgatgaggcagtttcaacagggtgctgctggcaacatgaaaggcatgatgggattcaataatatgtaa
Sequence Length
1515
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,369 Da
NCBI Official Full Name
Homo sapiens signal recognition particle 54kDa, mRNA
NCBI Official Synonym Full Names
signal recognition particle 54
NCBI Official Symbol
SRP54
NCBI Protein Information
signal recognition particle 54 kDa protein
UniProt Protein Name
Signal recognition particle 54 kDa protein
Protein Family
UniProt Gene Name
SRP54
UniProt Synonym Gene Names
SRP54
UniProt Entry Name
SRP54_HUMAN
Uniprot Description
SRP54: Binds to the signal sequence of presecretory protein when they emerge from the ribosomes and transfers them to TRAM (translocating chain-associating membrane protein). Belongs to the GTP-binding SRP family. SRP54 subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 14q13.2
Cellular Component: cytoplasm; cytosol; nucleolus; nucleus; signal recognition particle, endoplasmic reticulum targeting
Molecular Function: 7S RNA binding; drug binding; endoplasmic reticulum signal peptide binding; GDP binding; GTP binding; GTPase activity; protein binding; ribonucleoprotein binding
Biological Process: protein targeting to ER; response to drug; SRP-dependent cotranslational protein targeting to membrane; SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition; SRP-dependent cotranslational protein targeting to membrane, translocation
Research Articles on SRP54
Similar Products
Product Notes
The SRP54 srp54 (Catalog #AAA1277828) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttctag cagaccttgg aagaaaaata acatcagcat tacgctcgtt gagcaatgcc accattatca atgaagaggt attgaatgct atgctaaaag aagtctgtac cgctttgttg gaagcagatg ttaatattaa actagtgaag caactaagag aaaatgttaa gtctgctatt gatcttgaag agatggcatc tggtcttaac aaaagaaaaa tgattcagca tgctgtattt aaagaacttg tgaagcttgt agaccctgga gttaaggcat ggacacccac taaaggaaaa caaaatgtga ttatgtttgt tggattgcaa gggagtggta aaacaacaac atgttcaaag ctagcatatt attaccagag gaaaggttgg aagacctgtt taatatgtgc agacacattc agagcagggg cttttgacca actaaaacag aatgctacca aagcaagaat tccattttat ggaagctata cagaaatgga tcctgtcatc attgcttctg aaggagtaga gaaatttaaa aatgaaaatt ttgaaattat tattgttgat acaagtggcc gccacaaaca agaagactct ttgtttgaag aaatgcttca agttgctaat gctatacaac ctgataacat tgtttatgtg atggatgcct ccattgggca ggcttgtgaa gcccaggcta aggcttttaa agataaagta gatgtagcct cagtaatagt gacaaaactt gatggccatg caaaaggagg tggtgcactc agtgcagtcg ctgccacaaa aagtccgatt attttcattg gtacagggga acatatagat gactttgaac ctttcaaaac acagcctttt attagcaaac ttcttggtat gggcgacatt gaaggactga tagataaagt caacgagttg aagttggatg acaatgaagc acttatagag aagttgaaac atggtcagtt tacgttgcga gacatgtatg agcaatttca aaatatcatg aaaatgggcc ccttcagtca gatcttgggg atgatccctg gttttgggac agattttatg agcaaaggaa atgaacagga gtcaatggca aggctaaaga aattaatgac aataatggat agtatgaatg atcaagaact agacagtacg gatggtgcca aagtttttag taaacaacca ggaagaatcc aaagagtagc aagaggatcg ggtgtatcaa caagagatgt tcaagaactt ttgacacaat ataccaagtt tgcacagatg gtaaaaaaga tgggaggtat caaaggactt ttcaaaggtg gcgacatgtc taagaatgtg agccagtcac agatggcaaa attgaaccaa caaatggcca aaatgatgga tcctagggtt cttcatcaca tgggtggtat ggcaggactt cagtcaatga tgaggcagtt tcaacagggt gctgctggca acatgaaagg catgatggga ttcaataata tgtaa. It is sometimes possible for the material contained within the vial of "SRP54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
