SRP19 cdna clone
SRP19 cDNA Clone
Synonyms
SRP19; SRP19 cDNA Clone; SRP19 cdna clone
Sequence
atggcttgcactgccgcgcggtccccggccgaccaggacaggtttatttgtatctatcctgcttatttaaataataagaagaccatcgcagagggaaggcgaatccccataagtaaggctgttgaaaatcctacagctacagagattcaagatgtatgttcagcagttggacttaacgtatttcttgagaaaaataaaatgtactctagagaatggaatcgtgatgtccaatacagaggcagagtccgggtccagctcaaacaggaagatgggagcctctgccttgtacagttcccatcacgtaagtcagtaatgttgtatgcagcagaaatgatacctaaactaaaaacaaggacacaaaaaacaggaggtgctgaccaaagtcttcaacaaggagagggaagtaaaaaagggaaaggaaagaaaaagaagtaa
Sequence Length
435
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
8,739 Da
NCBI Official Full Name
Homo sapiens signal recognition particle 19kDa, mRNA
NCBI Official Synonym Full Names
signal recognition particle 19
NCBI Official Symbol
SRP19
NCBI Protein Information
signal recognition particle 19 kDa protein
UniProt Protein Name
Signal recognition particle 19 kDa protein
Protein Family
UniProt Gene Name
SRP19
UniProt Synonym Gene Names
SRP19
UniProt Entry Name
SRP19_HUMAN
Uniprot Description
SRP19: Signal-recognition-particle assembly, binds directly to 7S RNA and mediates binding of the 54 kDa subunit of the SRP. Belongs to the SRP19 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 5q21-q22
Cellular Component: cytoplasm; cytosol; mitochondrion; nucleolus; nucleus; signal recognition particle, endoplasmic reticulum targeting
Molecular Function: 7S RNA binding
Biological Process: cotranslational protein targeting to membrane; response to drug; SRP-dependent cotranslational protein targeting to membrane
Research Articles on SRP19
Similar Products
Product Notes
The SRP19 srp19 (Catalog #AAA1265897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttgca ctgccgcgcg gtccccggcc gaccaggaca ggtttatttg tatctatcct gcttatttaa ataataagaa gaccatcgca gagggaaggc gaatccccat aagtaaggct gttgaaaatc ctacagctac agagattcaa gatgtatgtt cagcagttgg acttaacgta tttcttgaga aaaataaaat gtactctaga gaatggaatc gtgatgtcca atacagaggc agagtccggg tccagctcaa acaggaagat gggagcctct gccttgtaca gttcccatca cgtaagtcag taatgttgta tgcagcagaa atgataccta aactaaaaac aaggacacaa aaaacaggag gtgctgacca aagtcttcaa caaggagagg gaagtaaaaa agggaaagga aagaaaaaga agtaa. It is sometimes possible for the material contained within the vial of "SRP19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
