Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPTLC2 cdna clone

SPTLC2 cDNA Clone

Gene Names
SPTLC2; LCB2; SPT2; HSN1C; LCB2A; NSAN1C; hLCB2a
Synonyms
SPTLC2; SPTLC2 cDNA Clone; SPTLC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggccggagcccggaggctgctgctgccgccgcacggtgcgggcgaatggctgcgtggcgaacggggaagtacggaacgggtacgtgaggagcagcgctgcagccgcagccgcagccgccgccggccagatccatcatgttacacaaaatggaggactatataaaagaccgtttaatgaagcttttgaagaaacaccaatgctggttgctgtgctcacgtatgtggggtatggcgtactcaccctctttggatatcttcgagatttcttgaggtattggagaattgaaaagtgtcaccatgcaacagaaagagaagaacaaaaggactttgtgtcattgtatcaagattttgaaaacttttatacaaggaatctgtacatgaggataagagacaactggaatcggccaatctgtagtgtgcctggagccagggtggacatcatggagagacagtctcatgattataactggtccttcaagtatacagggaatataataaagggtgttataaacatgggttcctacaactatcttggatttgcacggaatactggatcatgtcaagaagcagccgccaaagtccttgaggagtatggagctggagtgtgcagtactcggcaggaaattggaaacctggacaagcatgaagaactagaggagcttgtagcaaggttcttaggagtagaagctgctatggcgtatggcatgggatttgcaacgaattcaatgaacattcctgctcttgttggcaaaggttgcctgattctgagtgatgaactgaaccatgcatcactggttctgggagccagactgtcaggagcaaccattagaatcttcaaacacaacaatatgcaaagcctagagaagctattgaaagatgccattgtttatggtcagcctcggacacgaaggccctggaagaaaattctcatccttgtggaaggaatatatagcatggagggatctattgttcgtcttcctgaagtgattgccctcaagaagaaatacaaggcatacttgtatctggatgaggctcacagcattggcgccctgggccccacaggccggggtgtggtggagtactttggcctggatcccgaggatgtggatgttatgatgggaacgttcacaaagagttttggtgcttctggaggatatattggaggcaagaaggagctgatagactacctgcgaacacattctcatagtgcagtgtatgccacgtcattgtcacctcctgtagtggagcagatcatcacctccatgaagtgcatcatggggcaggatggcaccagccttggtaaagagtgtgtacaacagttagctgaaaacaccaggtatttcaggagacgcctgaaagagatgggcttcatcatctatggaaatgaagactctccagtagtgcctttgatgctctacatgcctgccaaaattggcgcctttggacgggagatgctgaagcggaacatcggtgtcgttgtggttggatttcctgccaccccaattattgagtccagagccaggttttgcctgtcagcagctcataccaaagaaatacttgatactgctttaaaggagatagatgaagttggggacctattgcagctgaagtattcccgtcatcggttggtacctctactggacaggccctttgacgagacgacgtatgaagaaacagaagactga
Sequence Length
1689
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,924 Da
NCBI Official Full Name
Homo sapiens serine palmitoyltransferase, long chain base subunit 2, mRNA
NCBI Official Synonym Full Names
serine palmitoyltransferase long chain base subunit 2
NCBI Official Symbol
SPTLC2
NCBI Official Synonym Symbols
LCB2; SPT2; HSN1C; LCB2A; NSAN1C; hLCB2a
NCBI Protein Information
serine palmitoyltransferase 2
UniProt Protein Name
Serine palmitoyltransferase 2
UniProt Gene Name
SPTLC2
UniProt Synonym Gene Names
KIAA0526; LCB2; LCB 2; LCB2a; SPT 2
UniProt Entry Name
SPTC2_HUMAN

NCBI Description

This gene encodes a long chain base subunit of serine palmitoyltransferase. Serine palmitoyltransferase, which consists of two different subunits, is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. Mutations in this gene were identified in patients with hereditary sensory neuropathy type I. [provided by RefSeq, Mar 2011]

Uniprot Description

SPTLC2: Serine palmitoyltransferase (SPT). The heterodimer formed with LCB1/SPTLC1 constitutes the catalytic core. The composition of the serine palmitoyltransferase (SPT) complex determines the substrate preference. The SPTLC1-SPTLC2-SSSPTA complex shows a strong preference for C16-CoA substrate, while the SPTLC1-SPTLC2-SSSPTB complex displays a preference for C18-CoA substrate. Defects in SPTLC2 are the cause of hereditary sensory and autonomic neuropathy type 1C (HSAN1C). It is a form of hereditary sensory and autonomic neuropathy, a genetically and clinically heterogeneous group of disorders characterized by degeneration of dorsal root and autonomic ganglion cells, and by prominent sensory abnormalities with a variable degree of motor and autonomic dysfunction. The neurological phenotype is often complicated by severe infections, osteomyelitis, and amputations. HSAN1C symptoms include loss of touch and vibration in the feet, dysesthesia and severe panmodal sensory loss in the upper and lower limbs, distal lower limb sensory loss with ulceration and osteomyelitis, and distal muscle weakness. Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.

Protein type: Membrane protein, integral; EC 2.3.1.50; Transferase; Lipid Metabolism - sphingolipid

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: endoplasmic reticulum membrane

Molecular Function: serine C-palmitoyltransferase activity

Biological Process: ceramide biosynthetic process; sphingolipid biosynthetic process

Disease: Neuropathy, Hereditary Sensory And Autonomic, Type Ic

Research Articles on SPTLC2

Similar Products

Product Notes

The SPTLC2 sptlc2 (Catalog #AAA1278008) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggccgg agcccggagg ctgctgctgc cgccgcacgg tgcgggcgaa tggctgcgtg gcgaacgggg aagtacggaa cgggtacgtg aggagcagcg ctgcagccgc agccgcagcc gccgccggcc agatccatca tgttacacaa aatggaggac tatataaaag accgtttaat gaagcttttg aagaaacacc aatgctggtt gctgtgctca cgtatgtggg gtatggcgta ctcaccctct ttggatatct tcgagatttc ttgaggtatt ggagaattga aaagtgtcac catgcaacag aaagagaaga acaaaaggac tttgtgtcat tgtatcaaga ttttgaaaac ttttatacaa ggaatctgta catgaggata agagacaact ggaatcggcc aatctgtagt gtgcctggag ccagggtgga catcatggag agacagtctc atgattataa ctggtccttc aagtatacag ggaatataat aaagggtgtt ataaacatgg gttcctacaa ctatcttgga tttgcacgga atactggatc atgtcaagaa gcagccgcca aagtccttga ggagtatgga gctggagtgt gcagtactcg gcaggaaatt ggaaacctgg acaagcatga agaactagag gagcttgtag caaggttctt aggagtagaa gctgctatgg cgtatggcat gggatttgca acgaattcaa tgaacattcc tgctcttgtt ggcaaaggtt gcctgattct gagtgatgaa ctgaaccatg catcactggt tctgggagcc agactgtcag gagcaaccat tagaatcttc aaacacaaca atatgcaaag cctagagaag ctattgaaag atgccattgt ttatggtcag cctcggacac gaaggccctg gaagaaaatt ctcatccttg tggaaggaat atatagcatg gagggatcta ttgttcgtct tcctgaagtg attgccctca agaagaaata caaggcatac ttgtatctgg atgaggctca cagcattggc gccctgggcc ccacaggccg gggtgtggtg gagtactttg gcctggatcc cgaggatgtg gatgttatga tgggaacgtt cacaaagagt tttggtgctt ctggaggata tattggaggc aagaaggagc tgatagacta cctgcgaaca cattctcata gtgcagtgta tgccacgtca ttgtcacctc ctgtagtgga gcagatcatc acctccatga agtgcatcat ggggcaggat ggcaccagcc ttggtaaaga gtgtgtacaa cagttagctg aaaacaccag gtatttcagg agacgcctga aagagatggg cttcatcatc tatggaaatg aagactctcc agtagtgcct ttgatgctct acatgcctgc caaaattggc gcctttggac gggagatgct gaagcggaac atcggtgtcg ttgtggttgg atttcctgcc accccaatta ttgagtccag agccaggttt tgcctgtcag cagctcatac caaagaaata cttgatactg ctttaaagga gatagatgaa gttggggacc tattgcagct gaagtattcc cgtcatcggt tggtacctct actggacagg ccctttgacg agacgacgta tgaagaaaca gaagactga. It is sometimes possible for the material contained within the vial of "SPTLC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.