Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPTLC1 cdna clone

SPTLC1 cDNA Clone

Gene Names
SPTLC1; HSN1; LBC1; LCB1; SPT1; SPTI; HSAN1
Synonyms
SPTLC1; SPTLC1 cDNA Clone; SPTLC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaccgccacggagcagtgggttctggtggagatggtacaggcgctttacgaggctcctgcttaccatcttattttggaagggattctgatcctctggataatcagacttcttttctctaagacttacaaattacaagaacgatctgatcttacagtcaaggaaaaagaagaactgattgaagagtggcaaccagaacctcttgttcctcctgtcccaaaagaccatcctgctctcaactacaacatcgtttcaggccctccaagccacaaaactgtggtgaatggaaaagaatgtataaacttcgcctcatttaattttcttggattgttggataaccctagggttaaggcagcagctttagcatctctaaagaagtatggcgtggggacttgtggacccagaggattttatggcacatttgatgttcatttggatttggaagaccgcctggcaaaatttatgaagacagaagaagccattatatactcatatggatttgccaccatagccagtgctattcctgcttactctaaaagaggggacattgtttttgtagatagagctgcctgctttgctattcagaaaggattacaggcatcccgtagtgacattaagttatttaagcataatgacatggctgacctcgagcgactactaaaagaacaagagatcgaagatcaaaagaatcctcgcaaggctcgtgtaactcggcgtttcattgtagtagaaggattgtatatgaatactggaactatttgtcctcttccagaattggttaagttaaaatacaaatacaaagcaagaatcttcctggaggaaagcctttcatttggagtcctaggagagcatggccgaggagtcactgaacactatggaatcaatattgatgatattgatcttatcagtgccaacatggagaatgcacttgcttctattggaggtttctgctgtggcaggtcttttgtaattgaccatcagcgactttccggccagggatactgcttttcagcttcgttacctcccctgttagctgctgcagcaattgaggccctcaacatcatggaagagaatccaggtatttttgcagtgttgaaggaaaagtgcggacaaattcataaagctttacaaggcatttctggattaaaagtggtgggggagtccctttctccagcctttcacctacaactggaagagagcactgggtctcgcgagcaagatgtcagactgcttcaggaaattgtagatcaatgcatgaacagaagtattgcattaactcgggcgcgctacttggagaaagaagagaagtgtctccctcctcccagaggaagaactggagagagctgcgtccaccatcaaggaggtagcccaggccgtcctgctctaggcagagtcccgggaccatggcctcctgccacacaacacgcagagaggactcaagactcccgctggccatggagtggcctgaaagagagcaagaacatgtggatctttgataggattgttaccaaatggtgtcagtatggaccaattgtgtga
Sequence Length
1542
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,073 Da
NCBI Official Full Name
Homo sapiens serine palmitoyltransferase, long chain base subunit 1, mRNA
NCBI Official Synonym Full Names
serine palmitoyltransferase long chain base subunit 1
NCBI Official Symbol
SPTLC1
NCBI Official Synonym Symbols
HSN1; LBC1; LCB1; SPT1; SPTI; HSAN1
NCBI Protein Information
serine palmitoyltransferase 1
UniProt Protein Name
Serine palmitoyltransferase 1
UniProt Gene Name
SPTLC1
UniProt Synonym Gene Names
LCB1; LCB 1; SPT 1; SPT1
UniProt Entry Name
SPTC1_HUMAN

NCBI Description

This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]

Uniprot Description

SPTLC1: Serine palmitoyltransferase (SPT). The heterodimer formed with SPTLC2 or SPTLC3 constitutes the catalytic core. The composition of the serine palmitoyltransferase (SPT) complex determines the substrate preference. The SPTLC1-SPTLC2-SPTSSA complex shows a strong preference for C16-CoA substrate, while the SPTLC1-SPTLC3-SPTSSA isozyme uses both C14-CoA and C16-CoA as substrates, with a slight preference for C14-CoA. The SPTLC1- SPTLC2-SPTSSB complex shows a strong preference for C18-CoA substrate, while the SPTLC1-SPTLC3-SPTSSB isozyme displays an ability to use a broader range of acyl-CoAs, without apparent preference. Defects in SPTLC1 are the cause of hereditary sensory and autonomic neuropathy type 1A (HSAN1A). The hereditary sensory and autonomic neuropathies are a genetically and clinically heterogeneous group of disorders characterized by degeneration of dorsal root and autonomic ganglion cells, and by sensory and/or autonomic abnormalities. HSAN1A is an autosomal dominant axonal neuropathy with onset in the second or third decades. Initial symptoms are loss of pain, touch, heat, and cold sensation over the feet, followed by distal muscle wasting and weakness. Loss of pain sensation leads to chronic skin ulcers and distal amputations. Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; EC 2.3.1.50; Lipid Metabolism - sphingolipid; Transferase

Chromosomal Location of Human Ortholog: 9q22.2

Cellular Component: endoplasmic reticulum membrane

Molecular Function: protein binding; serine C-palmitoyltransferase activity

Biological Process: ceramide biosynthetic process; sphingolipid biosynthetic process; sphingolipid metabolic process

Disease: Neuropathy, Hereditary Sensory And Autonomic, Type Ia

Research Articles on SPTLC1

Similar Products

Product Notes

The SPTLC1 sptlc1 (Catalog #AAA1278383) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccg ccacggagca gtgggttctg gtggagatgg tacaggcgct ttacgaggct cctgcttacc atcttatttt ggaagggatt ctgatcctct ggataatcag acttcttttc tctaagactt acaaattaca agaacgatct gatcttacag tcaaggaaaa agaagaactg attgaagagt ggcaaccaga acctcttgtt cctcctgtcc caaaagacca tcctgctctc aactacaaca tcgtttcagg ccctccaagc cacaaaactg tggtgaatgg aaaagaatgt ataaacttcg cctcatttaa ttttcttgga ttgttggata accctagggt taaggcagca gctttagcat ctctaaagaa gtatggcgtg gggacttgtg gacccagagg attttatggc acatttgatg ttcatttgga tttggaagac cgcctggcaa aatttatgaa gacagaagaa gccattatat actcatatgg atttgccacc atagccagtg ctattcctgc ttactctaaa agaggggaca ttgtttttgt agatagagct gcctgctttg ctattcagaa aggattacag gcatcccgta gtgacattaa gttatttaag cataatgaca tggctgacct cgagcgacta ctaaaagaac aagagatcga agatcaaaag aatcctcgca aggctcgtgt aactcggcgt ttcattgtag tagaaggatt gtatatgaat actggaacta tttgtcctct tccagaattg gttaagttaa aatacaaata caaagcaaga atcttcctgg aggaaagcct ttcatttgga gtcctaggag agcatggccg aggagtcact gaacactatg gaatcaatat tgatgatatt gatcttatca gtgccaacat ggagaatgca cttgcttcta ttggaggttt ctgctgtggc aggtcttttg taattgacca tcagcgactt tccggccagg gatactgctt ttcagcttcg ttacctcccc tgttagctgc tgcagcaatt gaggccctca acatcatgga agagaatcca ggtatttttg cagtgttgaa ggaaaagtgc ggacaaattc ataaagcttt acaaggcatt tctggattaa aagtggtggg ggagtccctt tctccagcct ttcacctaca actggaagag agcactgggt ctcgcgagca agatgtcaga ctgcttcagg aaattgtaga tcaatgcatg aacagaagta ttgcattaac tcgggcgcgc tacttggaga aagaagagaa gtgtctccct cctcccagag gaagaactgg agagagctgc gtccaccatc aaggaggtag cccaggccgt cctgctctag gcagagtccc gggaccatgg cctcctgcca cacaacacgc agagaggact caagactccc gctggccatg gagtggcctg aaagagagca agaacatgtg gatctttgat aggattgtta ccaaatggtg tcagtatgga ccaattgtgt ga. It is sometimes possible for the material contained within the vial of "SPTLC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.