Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPON2 cdna clone

SPON2 cDNA Clone

Gene Names
SPON2; DIL1; DIL-1; MINDIN; M-SPONDIN
Synonyms
SPON2; SPON2 cDNA Clone; SPON2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaaccccagcccggccgccgccctgggcaaggccctctgcgctctcctcctggccactctcggcgccgccggccagcctcttgggggagagtccatctgttccgccagagccccggccaaatacagcatcaccttcacgggcaagtggagccagacggccttccccaagcagtaccccctgttccgcccccctgcgcagtggtcttcgctgctgggggccgcgcatagctccgactacagcatgtggaggaagaaccagtacgtcagtaacgggctgcgcgactttgcggagcgcggcgaggcctgggcgctgatgaaggagatcgaggcggcgggggaggcgctgcagagcgtgcacgaggtgttttcggcgcccgccgtccccagcggcaccgggcagacgtcggcggagctggaggtgcagcgcaggcactcgctggtctcgtttgtggtgcgcatcgtgcccagccccgactggttcgtgggcgtggacagcctggacctgtgcgacggggaccgttggcgggaacaggcggcgctggacctgtacccctacgacgccgggacggacagcggcttcaccttctcctcccccaacttcgccaccatcccgcaggacacggtgaccgagataacgtcctcctctcccagccacccggccaactccttctactacccgcggctgaaggccctgcctcccatcgccagggtgacactgctgcggctgcgacagagccccagggccttcatccctcccgccccagtcctgcccagcagggacaatgagattgtagacagcgcctcagttccagaaacgccgctggactgcgaggtctccctgtggtcgtcctggggactgtgcggaggccactgtgggaggctcgggaccaagagcaggactcgctacgtccgggtccagcccgccaacaacgggagcccctgccccgagctcgaagaagaggctgagtgcgtccctgataactgcgtctaa
Sequence Length
996
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,846 Da
NCBI Official Full Name
Homo sapiens spondin 2, extracellular matrix protein, mRNA
NCBI Official Synonym Full Names
spondin 2
NCBI Official Symbol
SPON2
NCBI Official Synonym Symbols
DIL1; DIL-1; MINDIN; M-SPONDIN
NCBI Protein Information
spondin-2
UniProt Protein Name
Spondin-2
Protein Family
UniProt Gene Name
SPON2
UniProt Synonym Gene Names
DIL1; DIL-1
UniProt Entry Name
SPON2_HUMAN

Uniprot Description

SPON2: Cell adhesion protein that promotes adhesion and outgrowth of hippocampal embryonic neurons. Binds directly to bacteria and their components and functions as an opsonin for macrophage phagocytosis of bacteria. Essential in the initiation of the innate immune response and represents a unique pattern- recognition molecule in the ECM for microbial pathogens. Binds bacterial lipopolysaccharide (LPS).

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4p16.3

Molecular Function: protein binding

Biological Process: axon guidance

Research Articles on SPON2

Similar Products

Product Notes

The SPON2 spon2 (Catalog #AAA1266935) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaacc ccagcccggc cgccgccctg ggcaaggccc tctgcgctct cctcctggcc actctcggcg ccgccggcca gcctcttggg ggagagtcca tctgttccgc cagagccccg gccaaataca gcatcacctt cacgggcaag tggagccaga cggccttccc caagcagtac cccctgttcc gcccccctgc gcagtggtct tcgctgctgg gggccgcgca tagctccgac tacagcatgt ggaggaagaa ccagtacgtc agtaacgggc tgcgcgactt tgcggagcgc ggcgaggcct gggcgctgat gaaggagatc gaggcggcgg gggaggcgct gcagagcgtg cacgaggtgt tttcggcgcc cgccgtcccc agcggcaccg ggcagacgtc ggcggagctg gaggtgcagc gcaggcactc gctggtctcg tttgtggtgc gcatcgtgcc cagccccgac tggttcgtgg gcgtggacag cctggacctg tgcgacgggg accgttggcg ggaacaggcg gcgctggacc tgtaccccta cgacgccggg acggacagcg gcttcacctt ctcctccccc aacttcgcca ccatcccgca ggacacggtg accgagataa cgtcctcctc tcccagccac ccggccaact ccttctacta cccgcggctg aaggccctgc ctcccatcgc cagggtgaca ctgctgcggc tgcgacagag ccccagggcc ttcatccctc ccgccccagt cctgcccagc agggacaatg agattgtaga cagcgcctca gttccagaaa cgccgctgga ctgcgaggtc tccctgtggt cgtcctgggg actgtgcgga ggccactgtg ggaggctcgg gaccaagagc aggactcgct acgtccgggt ccagcccgcc aacaacggga gcccctgccc cgagctcgaa gaagaggctg agtgcgtccc tgataactgc gtctaa. It is sometimes possible for the material contained within the vial of "SPON2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.