SPINK7 cdna clone
SPINK7 cDNA Clone
Gene Names
SPINK7; ECG2; ECRG2
Synonyms
SPINK7; SPINK7 cDNA Clone; SPINK7 cdna clone
Sequence
ATGAAGATCACTGGGGGTCTCCTTCTGCTCTGTACAGTGGTCTATTTCTGTAGCAGCTCAGAAGCTGCTAGTCTGTCTCCAAAAAAAGTGGACTGCAGCATTTACAAGAAGTATCCAGTGGTGGCCATCCCCTGCCCCATCACATACCTACCAGTTTGTGGTTCTGACTACATCACCTATGGGAATGAATGTCACTTGTGTACCGAGAGCTTGAAAAGTAATGGAAGAGTTCAGTTTCTTCACGATGGAAGTTGCTAA
Sequence Length
258
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
9,232 Da
NCBI Official Full Name
Homo sapiens serine peptidase inhibitor, Kazal type 7 (putative), mRNA
NCBI Official Synonym Full Names
serine peptidase inhibitor, Kazal type 7 (putative)
NCBI Official Symbol
SPINK7
NCBI Official Synonym Symbols
ECG2; ECRG2
NCBI Protein Information
serine protease inhibitor Kazal-type 7
UniProt Protein Name
Serine protease inhibitor Kazal-type 7
Protein Family
UniProt Gene Name
SPINK7
UniProt Synonym Gene Names
ECG2; ECRG-2
UniProt Entry Name
ISK7_HUMAN
Uniprot Description
SPINK7: Probable serine protease inhibitor.
Protein type: Secreted; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 5q32
Molecular Function: protein binding; serine-type endopeptidase inhibitor activity
Research Articles on SPINK7
Similar Products
Product Notes
The SPINK7 spink7 (Catalog #AAA1269874) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAAGATCA CTGGGGGTCT CCTTCTGCTC TGTACAGTGG TCTATTTCTG TAGCAGCTCA GAAGCTGCTA GTCTGTCTCC AAAAAAAGTG GACTGCAGCA TTTACAAGAA GTATCCAGTG GTGGCCATCC CCTGCCCCAT CACATACCTA CCAGTTTGTG GTTCTGACTA CATCACCTAT GGGAATGAAT GTCACTTGTG TACCGAGAGC TTGAAAAGTA ATGGAAGAGT TCAGTTTCTT CACGATGGAA GTTGCTAA. It is sometimes possible for the material contained within the vial of "SPINK7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
