Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPG20 cdna clone

SPG20 cDNA Clone

Gene Names
SPG20; SPARTIN; TAHCCP1
Synonyms
SPG20; SPG20 cDNA Clone; SPG20 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcaagagccacaaaatggagaacctgctgaaattaagatcatcagagaagcatataagaaggcctttttatttgttaacaaaggtctgaatacagatgaattaggtcagaaggaagaagcaaagaactactataagcaaggaataggacacctgctcagagggatcagcatttcatcaaaagagtctgaacacacaggtactgggtgggaatctgctagacagatgcaacagaaaatgaaagaaactctacagaatgtacgcaccaggctggaaattctagagaagggtcttgccacttctctgcagaatgatcttcaggaggtgcccaagttatatccagaatttccacctaaagacatgtgtgaaaaattaccagagcctcagtcttttagttcagctcctcagcatgctgaagtaaatggaaacacctcaactccaagtgcaggggcagttgctgcacctgcttctctgtctttaccatcacaaagttgtccagcagaagctcctcctgcttatactcctcaagctgctgaaggtcactacactgtatcctatggaacagattctggggagttttcatcagttggagaggagttttataggaatcattctcagccaccgcctcttgagaccttagggctggatgcagatgaattgattttgataccaaatggagtacagattttttttgtaaatcctgcaggggaggttagtgcaccttcgtatcctgggtaccttcgaattgtgaggtttttggataattctctcgatacggttctaaaccgtcctcccgggtttcttcaggtttgtgactggttatatcctctagttcctgatagatctccggttctgaaatgtactgcgggagcctacatgtttcctgatacaatgctacaagcagcaggatgctttgtgggggtcgtcctgtcctctgagttaccagaggatgatagagagctctttgaggatctgttaaggcaaatgtctgaccttcggctccaggccaactggaacagagcagaagaagaaaatgaattccaaatccctggaagaactagaccctcctctgaccaactaaaagaagcctctggcactgatgtgaaacagttggaccaaggcaataaggatgtacgtcataaaggaaaacgtggaaaaagggctaaagatacttcaagtgaagaagttaacctgagtcacattgtaccatgtgagccagttccagaagaaaagccaaaagaattacatgaatggagtgaaaaagtggctcacaacattttgtcaggtgcttcctgggtgagttggggtttagtcaaaggtgctgagattactggtaaggcaatccagaaaggtgcttctaaactccgagagcggattcaaccagaagaaaaacccgtggaagttagtccagctgtcaccaagggactttatatagcgaagcaagctacaggaggagcagcaaaagtcagtcagttcctggttgatggagtttgcactgtagcaaattgcgttggaaaagaactagctccacatgtcaagaagcatggaagcaaacttgttccagaatctcttaaaaaagacaaagatgggaaatctcctctggatggtgctatggttgtagcagcgagtagtgttcaaggattttcaactgtctggcaaggattggaatgtgcagctaaatgcatcgttaacaatgtttcagcagaaactgtacaaactgtcagatacaaatacggatataatgcaggagaagctacccaccatgcggtggattctgcggtcaatgttggcgtaactgcctacaatattaacaacattggtatcaaagcaatggtgaagaaaactgcaacacaaacaggacacactctccttgaggactatcagatagttgataattctcagagggaaaatcaagaaggagcagcaaatgtcaacgtgagaggggagaaggatgagcagacgaaggaagtaaaggaggcaaagaagaaagataaatga
Sequence Length
2001
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,833 Da
NCBI Official Full Name
Homo sapiens spastic paraplegia 20 (Troyer syndrome), mRNA
NCBI Official Synonym Full Names
spastic paraplegia 20 (Troyer syndrome)
NCBI Official Symbol
SPG20
NCBI Official Synonym Symbols
SPARTIN; TAHCCP1
NCBI Protein Information
spartin
UniProt Protein Name
Spartin
Protein Family
UniProt Gene Name
SPG20
UniProt Synonym Gene Names
KIAA0610; TAHCCP1
UniProt Entry Name
SPG20_HUMAN

NCBI Description

This gene encodes a protein containing a MIT (Microtubule Interacting and Trafficking molecule) domain, and is implicated in regulating endosomal trafficking and mitochondria function. The protein localizes to mitochondria and partially co-localizes with microtubules. Stimulation with epidermal growth factor (EGF) results in protein translocation to the plasma membrane, and the protein functions in the degradation and intracellular trafficking of EGF receptor. Multiple alternatively spliced variants, encoding the same protein, have been identified. Mutations associated with this gene cause autosomal recessive spastic paraplegia 20 (Troyer syndrome). [provided by RefSeq, Nov 2008]

Uniprot Description

SPG20: May be implicated in endosomal trafficking, or microtubule dynamics, or both. Defects in SPG20 are the cause of spastic paraplegia autosomal recessive type 20 (SPG20); also known as Troyer syndrome (TRS). Spastic paraplegia is a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. SPG20 is characterized by dysarthria, distal amyotrophy, mild developmental delay and short stature.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 13q13.3

Cellular Component: cytoplasm; midbody; mitochondrial outer membrane; plasma membrane

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: abscission; cell division; regulation of mitochondrial membrane potential

Disease: Spastic Paraplegia 20, Autosomal Recessive

Research Articles on SPG20

Similar Products

Product Notes

The SPG20 spg20 (Catalog #AAA1269871) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaag agccacaaaa tggagaacct gctgaaatta agatcatcag agaagcatat aagaaggcct ttttatttgt taacaaaggt ctgaatacag atgaattagg tcagaaggaa gaagcaaaga actactataa gcaaggaata ggacacctgc tcagagggat cagcatttca tcaaaagagt ctgaacacac aggtactggg tgggaatctg ctagacagat gcaacagaaa atgaaagaaa ctctacagaa tgtacgcacc aggctggaaa ttctagagaa gggtcttgcc acttctctgc agaatgatct tcaggaggtg cccaagttat atccagaatt tccacctaaa gacatgtgtg aaaaattacc agagcctcag tcttttagtt cagctcctca gcatgctgaa gtaaatggaa acacctcaac tccaagtgca ggggcagttg ctgcacctgc ttctctgtct ttaccatcac aaagttgtcc agcagaagct cctcctgctt atactcctca agctgctgaa ggtcactaca ctgtatccta tggaacagat tctggggagt tttcatcagt tggagaggag ttttatagga atcattctca gccaccgcct cttgagacct tagggctgga tgcagatgaa ttgattttga taccaaatgg agtacagatt ttttttgtaa atcctgcagg ggaggttagt gcaccttcgt atcctgggta ccttcgaatt gtgaggtttt tggataattc tctcgatacg gttctaaacc gtcctcccgg gtttcttcag gtttgtgact ggttatatcc tctagttcct gatagatctc cggttctgaa atgtactgcg ggagcctaca tgtttcctga tacaatgcta caagcagcag gatgctttgt gggggtcgtc ctgtcctctg agttaccaga ggatgataga gagctctttg aggatctgtt aaggcaaatg tctgaccttc ggctccaggc caactggaac agagcagaag aagaaaatga attccaaatc cctggaagaa ctagaccctc ctctgaccaa ctaaaagaag cctctggcac tgatgtgaaa cagttggacc aaggcaataa ggatgtacgt cataaaggaa aacgtggaaa aagggctaaa gatacttcaa gtgaagaagt taacctgagt cacattgtac catgtgagcc agttccagaa gaaaagccaa aagaattaca tgaatggagt gaaaaagtgg ctcacaacat tttgtcaggt gcttcctggg tgagttgggg tttagtcaaa ggtgctgaga ttactggtaa ggcaatccag aaaggtgctt ctaaactccg agagcggatt caaccagaag aaaaacccgt ggaagttagt ccagctgtca ccaagggact ttatatagcg aagcaagcta caggaggagc agcaaaagtc agtcagttcc tggttgatgg agtttgcact gtagcaaatt gcgttggaaa agaactagct ccacatgtca agaagcatgg aagcaaactt gttccagaat ctcttaaaaa agacaaagat gggaaatctc ctctggatgg tgctatggtt gtagcagcga gtagtgttca aggattttca actgtctggc aaggattgga atgtgcagct aaatgcatcg ttaacaatgt ttcagcagaa actgtacaaa ctgtcagata caaatacgga tataatgcag gagaagctac ccaccatgcg gtggattctg cggtcaatgt tggcgtaact gcctacaata ttaacaacat tggtatcaaa gcaatggtga agaaaactgc aacacaaaca ggacacactc tccttgagga ctatcagata gttgataatt ctcagaggga aaatcaagaa ggagcagcaa atgtcaacgt gagaggggag aaggatgagc agacgaagga agtaaaggag gcaaagaaga aagataaatg a. It is sometimes possible for the material contained within the vial of "SPG20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.