SPESP1 cdna clone
SPESP1 cDNA Clone
Gene Names
SPESP1; ESP; SP-ESP
Synonyms
SPESP1; SPESP1 cDNA Clone; SPESP1 cdna clone
Sequence
atgaagcccttagtccttctagttgcgcttttgctatggccttcgtctgtgccggcttatccgagcataactgtgacacctgatgaagagcaaaacttgaatcattatatacaagttttagagaacctagtacgaagtgttccctctggggagccaggtcgtgagaaaaaatctaactctccaaaacatgtttattctatagcatcaaagggatcaaaatttaaggagctagttacacatggagacgcttcaactgagaatgatgttttaaccaatcctatcagtgaagaaactacaactttccctacaggaggcttcacaccggaaataggaaagaaaaaacacacggaaagtaccccattctggtcgatcaaaccaaacaatgtttccattgttttgcatgcagaggaaccttatattgaaaatgaagagccagagccagagccggagccagctgcaaaacaaactgaggcaccaagaatgttgccagttgttactgaatcatctacaagtccatatgttacctcatacaagtcacctgtcaccactttagataagagcactggcattgggatctctacagaatcagaagatgttcctcagctctcaggtgaaactgcgatagaaaaacccgaagagtttggaaagcacccagagagttggaataatgatgacattttgaaaaaaattttagatattaattcacaagtgcaacaggcacttcttagtgacaccagcaacccagcatatagagaagatattgaagcctctaaagatcacctaaaacgaagccttgctctagcagcagcagcagaacataaattaaaaacaatgtataagtcccagttattgccagtaggacgaacaagtaataaaattgatgacatcgaaactgttattaacatgctgtgtaattctagatctaaactctatgaatatttagatattaaatgtgttccaccagagatgagagaaaaagctgctacagtattcaatacattaaaaaatatgtgtagatcaaggagagtcacagccttattaaaagtttattaa
Sequence Length
1053
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,931 Da
NCBI Official Full Name
Homo sapiens sperm equatorial segment protein 1, mRNA
NCBI Official Synonym Full Names
sperm equatorial segment protein 1
NCBI Official Symbol
SPESP1
NCBI Official Synonym Symbols
ESP; SP-ESP
NCBI Protein Information
sperm equatorial segment protein 1
UniProt Protein Name
Sperm equatorial segment protein 1
Protein Family
UniProt Gene Name
SPESP1
UniProt Synonym Gene Names
ESP; Equatorial segment protein; SP-ESP
UniProt Entry Name
SPESP_HUMAN
NCBI Description
The encoded protein is a human alloantigen involved in sperm-egg binding and fusion. [provided by RefSeq, Apr 2010]
Uniprot Description
SPESP1: The encoded protein is a human alloantigen involved in sperm-egg binding and fusion. [provided by RefSeq, Apr 2010]
Protein type: Secreted, signal peptide; Cytoskeletal; Secreted
Chromosomal Location of Human Ortholog: 15q23
Cellular Component: acrosome
Biological Process: acrosome reaction; fusion of sperm to egg plasma membrane
Research Articles on SPESP1
Similar Products
Product Notes
The SPESP1 spesp1 (Catalog #AAA1273018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccct tagtccttct agttgcgctt ttgctatggc cttcgtctgt gccggcttat ccgagcataa ctgtgacacc tgatgaagag caaaacttga atcattatat acaagtttta gagaacctag tacgaagtgt tccctctggg gagccaggtc gtgagaaaaa atctaactct ccaaaacatg tttattctat agcatcaaag ggatcaaaat ttaaggagct agttacacat ggagacgctt caactgagaa tgatgtttta accaatccta tcagtgaaga aactacaact ttccctacag gaggcttcac accggaaata ggaaagaaaa aacacacgga aagtacccca ttctggtcga tcaaaccaaa caatgtttcc attgttttgc atgcagagga accttatatt gaaaatgaag agccagagcc agagccggag ccagctgcaa aacaaactga ggcaccaaga atgttgccag ttgttactga atcatctaca agtccatatg ttacctcata caagtcacct gtcaccactt tagataagag cactggcatt gggatctcta cagaatcaga agatgttcct cagctctcag gtgaaactgc gatagaaaaa cccgaagagt ttggaaagca cccagagagt tggaataatg atgacatttt gaaaaaaatt ttagatatta attcacaagt gcaacaggca cttcttagtg acaccagcaa cccagcatat agagaagata ttgaagcctc taaagatcac ctaaaacgaa gccttgctct agcagcagca gcagaacata aattaaaaac aatgtataag tcccagttat tgccagtagg acgaacaagt aataaaattg atgacatcga aactgttatt aacatgctgt gtaattctag atctaaactc tatgaatatt tagatattaa atgtgttcca ccagagatga gagaaaaagc tgctacagta ttcaatacat taaaaaatat gtgtagatca aggagagtca cagccttatt aaaagtttat taa. It is sometimes possible for the material contained within the vial of "SPESP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
