Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPDEF cdna clone

SPDEF cDNA Clone

Gene Names
SPDEF; PDEF; bA375E1.3
Synonyms
SPDEF; SPDEF cDNA Clone; SPDEF cdna clone
Ordering
For Research Use Only!
Sequence
atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttctacctctcctactttgacatgctgtaccctgaggacagcagctgggcagccaaggcccctggggccagcagtcgggaggagccacctgaggagcctgagcagtgcccggtcattgacagccaagccccagcgggcagcctggacttggtgcccggcgggctgaccttggaggagcactcgctggagcaggtgcagtccatggtggtgggcgaagtgctcaaggacatcgagacggcctgcaagctgctcaacatcaccgcagatcccatggactggagccccagcaatgtgcagaagtggctcctgtggacagagcaccaataccggctgccccccatgggcaaggccttccaggagctggcgggcaaggagctgtgcgccatgtcggaggagcagttccgccagcgctcgcccctgggtggggatgtgctgcacgcccacctggacatctggaagtcagcggcctggatgaaagagcggacttcacctggggcgattcactactgtgcctcgaccagtgaggagagctggaccgacagcgaggtggactcatcatgctccgggcagcccatccacctgtggcagttcctcaaggagttgctactcaagccccacagctatggccgcttcattaggtggctcaacaaggagaagggcatcttcaaaattgaggactcagcccaggtggcccggctgtggggcatccgcaagaaccgtcccgccatgaactacgacaagctgagccgctccatccgccagtattacaagaagggcatcatccggaagccagacatctcccagcgcctcgtctaccagttcgtgcaccccatctga
Sequence Length
1008
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,715 Da
NCBI Official Full Name
Homo sapiens SAM pointed domain containing ets transcription factor, mRNA
NCBI Official Synonym Full Names
SAM pointed domain containing ETS transcription factor
NCBI Official Symbol
SPDEF
NCBI Official Synonym Symbols
PDEF; bA375E1.3
NCBI Protein Information
SAM pointed domain-containing Ets transcription factor
UniProt Protein Name
SAM pointed domain-containing Ets transcription factor
UniProt Gene Name
SPDEF
UniProt Synonym Gene Names
PDEF; PSE; Prostate-specific Ets
UniProt Entry Name
SPDEF_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

SPDEF: May function as an androgen-independent transactivator of the prostate-specific antigen (PSA) promoter. Binds to 5'-GGAT- 3' DNA sequences. May play a role in the regulation of the prostate gland and/or prostate cancer development. Acts as a transcriptional activator for SERPINB5 promoter. Belongs to the ETS family.

Protein type: Motility/polarity/chemotaxis; Nuclear receptor co-regulator; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: nucleus

Biological Process: cell differentiation; multicellular organismal development; negative regulation of transcription from RNA polymerase II promoter; positive regulation of apoptosis

Research Articles on SPDEF

Similar Products

Product Notes

The SPDEF spdef (Catalog #AAA1278768) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcagcg ccagcccggg tctgagcagc gtatccccca gccacctcct gctgcccccc gacacggtgt cgcggacagg cttggagaag gcggcagcgg gggcagtggg tctcgagaga cgggactgga gtcccagtcc acccgccacg cccgagcagg gcctgtccgc cttctacctc tcctactttg acatgctgta ccctgaggac agcagctggg cagccaaggc ccctggggcc agcagtcggg aggagccacc tgaggagcct gagcagtgcc cggtcattga cagccaagcc ccagcgggca gcctggactt ggtgcccggc gggctgacct tggaggagca ctcgctggag caggtgcagt ccatggtggt gggcgaagtg ctcaaggaca tcgagacggc ctgcaagctg ctcaacatca ccgcagatcc catggactgg agccccagca atgtgcagaa gtggctcctg tggacagagc accaataccg gctgcccccc atgggcaagg ccttccagga gctggcgggc aaggagctgt gcgccatgtc ggaggagcag ttccgccagc gctcgcccct gggtggggat gtgctgcacg cccacctgga catctggaag tcagcggcct ggatgaaaga gcggacttca cctggggcga ttcactactg tgcctcgacc agtgaggaga gctggaccga cagcgaggtg gactcatcat gctccgggca gcccatccac ctgtggcagt tcctcaagga gttgctactc aagccccaca gctatggccg cttcattagg tggctcaaca aggagaaggg catcttcaaa attgaggact cagcccaggt ggcccggctg tggggcatcc gcaagaaccg tcccgccatg aactacgaca agctgagccg ctccatccgc cagtattaca agaagggcat catccggaag ccagacatct cccagcgcct cgtctaccag ttcgtgcacc ccatctga. It is sometimes possible for the material contained within the vial of "SPDEF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.