SPATC1 cdna clone
SPATC1 cDNA Clone
Gene Names
SPATC1; SPATA15
Synonyms
SPATC1; SPATC1 cDNA Clone; SPATC1 cdna clone
Sequence
atggccttggcacccctggccgagatgctaaccagcttgcagcccagcgccacaccgggctcactcatgagccccctgacaggcaccctcagcacgctgctgtctggcccagcacccacgtcacagagcagccccctcaccagcttcctgaccagtcccattgcgggacccctaacaggcacactggccagttccctgggcctgccctccactggcaccctgactcccagcagcctcgtggcaggccctgtggccatgtcccagagcagccccctgatagcccctgtgatgggcacggtggctgtctctctgagcagccccctcctcagctccactgccaccccaccaggggtctctcagaacctgctggccaaccccatgagcaacctggtcctgccagaggccccaaggctgcggctggctgagccactccgcggaggccccactgggccccagtccccagcttgcgtggtacccactgccaccaccaaagtcccactctccactgagcccccccagtcgacccaggacccagagcctctcagcatggcgtttgcaggagcacccctccagacctccacccctatcggagccatgggcacacctgctcccaagacggccttctccttcaacacttcggacacacaggcccagcccagtgccgcccaggaacaagtggtccctgcatctgtccccacctcccccaccacctcccccacggtcaccgtccttgcctctgcccccgcccttgccccccaggttgccaccagctacacaccctcaagcaccacccacatcgcccagggtgccccccatcccccttcccgaatgcataattccccaacccagaacctgcctgtcccccactgtcctccacacaacgcccactccccacctcgtacctcatcctccccggcttcagtcaatgactctcgaggtccacgcaccacagaaccgtcgacgaagagcatgatggaggtggaacggaagctggcccaccgcaagaccagcaagttccccgagaacccccgagagtcgaagcagctggcctgggagaggctggtgggtgagattgccttccagctggaccgcaggatcctgtccagcatcttcccagagcgcgtacggctctacggcttcactgtctccaacatcccagagaagatcatccaggcttccctgaaccccagtgaccacaagctggatgagaagctgtgccagaggctcacacagcgctatgtgagcgtcatgaacaggctgcagagtctgggctacaacgggcgggtgcaccctgcgctgaccgagcagctggtgaacgcttatggcatcctgcgagagcgcccggagctggcggcgtctgagggcggcccctacaccgtggacttcctgcagcgtgtggtggtggagaccgtgcaccccggcatgctcgccgacgcgctgctgctgctctcctgcctcagccagctggcgcacgatgacggcaagcccatgttcatctggtga
Sequence Length
1503
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,355 Da
NCBI Official Full Name
Homo sapiens spermatogenesis and centriole associated 1, mRNA
NCBI Official Synonym Full Names
spermatogenesis and centriole associated 1
NCBI Official Symbol
SPATC1
NCBI Official Synonym Symbols
SPATA15
NCBI Protein Information
speriolin
UniProt Protein Name
Speriolin
Protein Family
UniProt Gene Name
SPATC1
UniProt Synonym Gene Names
SPATA15; SPRN
UniProt Entry Name
SPERI_HUMAN
Uniprot Description
SPATC1: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 8q24.3
Cellular Component: centrosome
Research Articles on SPATC1
Similar Products
Product Notes
The SPATC1 spatc1 (Catalog #AAA1269523) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccttgg cacccctggc cgagatgcta accagcttgc agcccagcgc cacaccgggc tcactcatga gccccctgac aggcaccctc agcacgctgc tgtctggccc agcacccacg tcacagagca gccccctcac cagcttcctg accagtccca ttgcgggacc cctaacaggc acactggcca gttccctggg cctgccctcc actggcaccc tgactcccag cagcctcgtg gcaggccctg tggccatgtc ccagagcagc cccctgatag cccctgtgat gggcacggtg gctgtctctc tgagcagccc cctcctcagc tccactgcca ccccaccagg ggtctctcag aacctgctgg ccaaccccat gagcaacctg gtcctgccag aggccccaag gctgcggctg gctgagccac tccgcggagg ccccactggg ccccagtccc cagcttgcgt ggtacccact gccaccacca aagtcccact ctccactgag cccccccagt cgacccagga cccagagcct ctcagcatgg cgtttgcagg agcacccctc cagacctcca cccctatcgg agccatgggc acacctgctc ccaagacggc cttctccttc aacacttcgg acacacaggc ccagcccagt gccgcccagg aacaagtggt ccctgcatct gtccccacct cccccaccac ctcccccacg gtcaccgtcc ttgcctctgc ccccgccctt gccccccagg ttgccaccag ctacacaccc tcaagcacca cccacatcgc ccagggtgcc ccccatcccc cttcccgaat gcataattcc ccaacccaga acctgcctgt cccccactgt cctccacaca acgcccactc cccacctcgt acctcatcct ccccggcttc agtcaatgac tctcgaggtc cacgcaccac agaaccgtcg acgaagagca tgatggaggt ggaacggaag ctggcccacc gcaagaccag caagttcccc gagaaccccc gagagtcgaa gcagctggcc tgggagaggc tggtgggtga gattgccttc cagctggacc gcaggatcct gtccagcatc ttcccagagc gcgtacggct ctacggcttc actgtctcca acatcccaga gaagatcatc caggcttccc tgaaccccag tgaccacaag ctggatgaga agctgtgcca gaggctcaca cagcgctatg tgagcgtcat gaacaggctg cagagtctgg gctacaacgg gcgggtgcac cctgcgctga ccgagcagct ggtgaacgct tatggcatcc tgcgagagcg cccggagctg gcggcgtctg agggcggccc ctacaccgtg gacttcctgc agcgtgtggt ggtggagacc gtgcaccccg gcatgctcgc cgacgcgctg ctgctgctct cctgcctcag ccagctggcg cacgatgacg gcaagcccat gttcatctgg tga. It is sometimes possible for the material contained within the vial of "SPATC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
