Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPAG8 cdna clone

SPAG8 cDNA Clone

Gene Names
SPAG8; SMP1; BS-84; CT142; HSD-1; SPAG3; CILD28; hSMP-1
Synonyms
SPAG8; SPAG8 cDNA Clone; SPAG8 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaccaacgggtctacggagggatcgcggtcgcggtcgcgatctttagacatacagcccagctccgaaggactggggcccacttcggaaccgtttccttcttcagatgacagtcccaggtcggccctggcagctgcaaccgcagcagctgcagcggctgcatcagctgctgcagctactgcagccttcaccactgccaaagcagctgcattatctacaaagaccccagcgccctgttctgagttcatggagccgtcctctgaccccagccttcttggggagccctgtgcgggacccggctttacccacaatatagcccatgggagtcttggctttgagcccgtctatgtttcctgtattgctcaggacacttgcactacaactgaccatagttctaatcctggccctgttccaggctctagctctgggcctgttcttggttccagctcaggtgctggccatggctctggctctggctctggtcctggctgtggctctgtccctggctctggctctggtcctggtcctggctctggtcctggctctggtcctggtcatggctctggctctcatcctggtcctgcctctgggcctggtccagacactggccctgactctgagctcagcccctgtattcctccagggttcagaaacctggtggcagatcgggtccttaactatacctcctggagtcagcactgcccctgggagccccagaaacaaccaccttgggaatttttgcaagtcttagaaccgggtgcccgaggattatggaaacccccagacattaaagggaagcttatggtttgctatgaaactttgccgcggggccagtgcctcctctacaactgggaggaagagagagccaccaaccacctggatcaagtcccaagcatgcaggatggctctgagagttttttcttccgacacggacaccggggactgctgactatgcaactaaagtcacccatgccctccagcaccacccagaaagactcgtaccagccaccaggaaacgtctattggccacttcgagggaagcgtgaagccatgctggagatgctcctgcagcatcagatctgtaaagaggtgcaggcagaacaggaacccacaaggaagctcttcgaggttgagtctgtgacacaccatgactaccgaatggagctggcacaagcagggactcctgccccaacaaagcctcacgactaccgccaggagcaacctgagaccttctggatacagagggcaccacagctgccgacatggtggccattgcccacccaggtaccagcagcagaagactatctgacttggaaagaatgggggtttacaggagtccaggaggtcctttccgctctcctaagagccacacctggtgaatactcagtaaacatttgcggaatgaatgaacaccctgtctgcagcaggacatggacaaataggctctgccatcaggaaatgggaagcaagaaaacggtaactcaagaggacagaggctggtga
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,139 Da
NCBI Official Full Name
Homo sapiens sperm associated antigen 8, mRNA
NCBI Official Synonym Full Names
sperm associated antigen 8
NCBI Official Symbol
SPAG8
NCBI Official Synonym Symbols
SMP1; BS-84; CT142; HSD-1; SPAG3; CILD28; hSMP-1
NCBI Protein Information
sperm-associated antigen 8
UniProt Protein Name
Sperm-associated antigen 8
Protein Family
UniProt Gene Name
SPAG8
UniProt Synonym Gene Names
SMP-1
UniProt Entry Name
SPAG8_HUMAN

NCBI Description

The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]

Uniprot Description

SPAG8: May play a role in fertility and microtubule formation through interaction with RANBP9. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 9p13.3

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of transcription from RNA polymerase II promoter

Research Articles on SPAG8

Similar Products

Product Notes

The SPAG8 spag8 (Catalog #AAA1269319) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacca acgggtctac ggagggatcg cggtcgcggt cgcgatcttt agacatacag cccagctccg aaggactggg gcccacttcg gaaccgtttc cttcttcaga tgacagtccc aggtcggccc tggcagctgc aaccgcagca gctgcagcgg ctgcatcagc tgctgcagct actgcagcct tcaccactgc caaagcagct gcattatcta caaagacccc agcgccctgt tctgagttca tggagccgtc ctctgacccc agccttcttg gggagccctg tgcgggaccc ggctttaccc acaatatagc ccatgggagt cttggctttg agcccgtcta tgtttcctgt attgctcagg acacttgcac tacaactgac catagttcta atcctggccc tgttccaggc tctagctctg ggcctgttct tggttccagc tcaggtgctg gccatggctc tggctctggc tctggtcctg gctgtggctc tgtccctggc tctggctctg gtcctggtcc tggctctggt cctggctctg gtcctggtca tggctctggc tctcatcctg gtcctgcctc tgggcctggt ccagacactg gccctgactc tgagctcagc ccctgtattc ctccagggtt cagaaacctg gtggcagatc gggtccttaa ctatacctcc tggagtcagc actgcccctg ggagccccag aaacaaccac cttgggaatt tttgcaagtc ttagaaccgg gtgcccgagg attatggaaa cccccagaca ttaaagggaa gcttatggtt tgctatgaaa ctttgccgcg gggccagtgc ctcctctaca actgggagga agagagagcc accaaccacc tggatcaagt cccaagcatg caggatggct ctgagagttt tttcttccga cacggacacc ggggactgct gactatgcaa ctaaagtcac ccatgccctc cagcaccacc cagaaagact cgtaccagcc accaggaaac gtctattggc cacttcgagg gaagcgtgaa gccatgctgg agatgctcct gcagcatcag atctgtaaag aggtgcaggc agaacaggaa cccacaagga agctcttcga ggttgagtct gtgacacacc atgactaccg aatggagctg gcacaagcag ggactcctgc cccaacaaag cctcacgact accgccagga gcaacctgag accttctgga tacagagggc accacagctg ccgacatggt ggccattgcc cacccaggta ccagcagcag aagactatct gacttggaaa gaatgggggt ttacaggagt ccaggaggtc ctttccgctc tcctaagagc cacacctggt gaatactcag taaacatttg cggaatgaat gaacaccctg tctgcagcag gacatggaca aataggctct gccatcagga aatgggaagc aagaaaacgg taactcaaga ggacagaggc tggtga. It is sometimes possible for the material contained within the vial of "SPAG8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.