Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SOX7 cdna clone

SOX7 cDNA Clone

Synonyms
SOX7; SOX7 cDNA Clone; SOX7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcgctgctgggagcctacccttggcccgagggtctcgagtgcccggccctggacgccgagctgtcggatggacaatcgccgccggccgtcccccggcccccgggggacaagggctccgagagccgtatccggcggcccatgaacgccttcatggtttgggccaaggacgagaggaaacggctggcagtgcagaacccggacctgcacaacgccgagctcagcaagatgctgggaaagtcgtggaaggcgctgacgctgtcccagaagaggccgtacgtggacgaggcggagcggctgcgcctgcagcacatgcaggactaccccaactacaagtaccggccgcgcaggaagaagcaggccaagcggctgtgcaagcgcgtggacccgggcttccttctgagctccctctcccgggaccagaacgccctgccggagaagagaagcggcagccggggggcgctgggggagaaggaggacaggggtgagtactcccccggcactgccctgcccagcctccggggctgctaccacgaggggccggctggtggtggcggcggcggcaccccgagcagtgtggacacgtacccgtacgggctgcccacacctcctgaaatgtctcccctggacgtgctggagccggagcagaccttcttctcctccccctgccaggaggagcatggccatccccgccgcatcccccacctgccagggcacccgtactcaccggagtacgccccaagccctctccactgtagccaccccctgggctccctggcccttggccagtcccccggcgtctccatgatgtcccctgtacccggctgtcccccatctcctgcctattactccccggccacctaccacccactccactccaacctccaagcccacctgggccagctctccccgcctcctgagcaccctggcttcgacgccctggatcaactgagccaggtggaactcctgggggacatggatcgcaatgaattcgaccagtatttgaacactcctggccacccagactccgccacaggggccatggccctcagtgggcatgttccggtctcccaggtgacaccaacgggtcccacagagaccagcctcatctccgtcctggctgatgccacggccacgtactacaacagctacagtgtgtcatag
Sequence Length
1167
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,522 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 7, mRNA
NCBI Official Synonym Full Names
SRY-box 7
NCBI Official Symbol
SOX7
NCBI Protein Information
transcription factor SOX-7
UniProt Protein Name
Transcription factor SOX-7
Protein Family
UniProt Gene Name
SOX7
UniProt Entry Name
SOX7_HUMAN

NCBI Description

This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]

Uniprot Description

SOX7: Binds to and activates the CDH5 promoter, hence plays a role in the transcriptional regulation of genes expressed in the hemogenic endothelium and blocks further differentiation into blood precursors. May be required for the survival of both hematopoietic and endothelial precursors during specification. Competes with GATA4 for binding and activation of the FGF3 promoter. Represses Wnt/beta-catenin-stimulated transcription, probably by targeting CTNNB1 to proteasomal degradation. Binds the DNA sequence 5'- AACAAT-3'.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 8p23.1

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: endoderm formation; negative regulation of cell proliferation; negative regulation of transcription, DNA-dependent; positive regulation of caspase activity

Research Articles on SOX7

Similar Products

Product Notes

The SOX7 sox7 (Catalog #AAA1265794) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcgc tgctgggagc ctacccttgg cccgagggtc tcgagtgccc ggccctggac gccgagctgt cggatggaca atcgccgccg gccgtccccc ggcccccggg ggacaagggc tccgagagcc gtatccggcg gcccatgaac gccttcatgg tttgggccaa ggacgagagg aaacggctgg cagtgcagaa cccggacctg cacaacgccg agctcagcaa gatgctggga aagtcgtgga aggcgctgac gctgtcccag aagaggccgt acgtggacga ggcggagcgg ctgcgcctgc agcacatgca ggactacccc aactacaagt accggccgcg caggaagaag caggccaagc ggctgtgcaa gcgcgtggac ccgggcttcc ttctgagctc cctctcccgg gaccagaacg ccctgccgga gaagagaagc ggcagccggg gggcgctggg ggagaaggag gacaggggtg agtactcccc cggcactgcc ctgcccagcc tccggggctg ctaccacgag gggccggctg gtggtggcgg cggcggcacc ccgagcagtg tggacacgta cccgtacggg ctgcccacac ctcctgaaat gtctcccctg gacgtgctgg agccggagca gaccttcttc tcctccccct gccaggagga gcatggccat ccccgccgca tcccccacct gccagggcac ccgtactcac cggagtacgc cccaagccct ctccactgta gccaccccct gggctccctg gcccttggcc agtcccccgg cgtctccatg atgtcccctg tacccggctg tcccccatct cctgcctatt actccccggc cacctaccac ccactccact ccaacctcca agcccacctg ggccagctct ccccgcctcc tgagcaccct ggcttcgacg ccctggatca actgagccag gtggaactcc tgggggacat ggatcgcaat gaattcgacc agtatttgaa cactcctggc cacccagact ccgccacagg ggccatggcc ctcagtgggc atgttccggt ctcccaggtg acaccaacgg gtcccacaga gaccagcctc atctccgtcc tggctgatgc cacggccacg tactacaaca gctacagtgt gtcatag. It is sometimes possible for the material contained within the vial of "SOX7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.