SOX30 cdna clone
SOX30 cDNA Clone
Synonyms
SOX30; SOX30 cDNA Clone; SOX30 cdna clone
Sequence
atggagagagccagacccgagccgccgcctcagccgcgcccgttgcgtcccgctccgcccccgctgccggtcgagggcacctccttttgggcagcagccatggagccccctccgtcgtctcccacactgagcgcggcagccagtgcgaccttggcctcgtcgtgcggggaggcagtggcgtccggcttacagcccgcggtgcggcggctgctgcaggtgaagccagagcaggtgttgctgctaccacagcctcaggcccagaacgaggaagccgctgcctcgtccgcgcaggcgcggctgttgcagttcaggcccgacctgcggctcctgcagccgccgacagcgtcagacggcgccacctccaggcccgagttgcacccggtgcagcccctggcgctgcatgtcaaggccaagaagcagaagctggggcccagcctggatcagtcagtggggcctcgaggggccgtcgaaaccggtcctagagcctccagggtggtcaagttggaaggccccgggccggccctcggctacttccgaggggacgagaagggcaagctggaggcggaggaggtcatgagagactcgatgcaaggcggggcaggcaaaagcccggcagccatccgagaaggtgtgatcaaaacggaggaacccgagagactcctcgaggactgcaggctcggcgcggagcccgcgtccaatggcctggttcatggcagcgcggaggtcatcttggccccaacgtccggtgcctttgggccgcaccagcaagaccttaggatccctttgacgctccacacggtcccccctggggcccggatccagtttcagggagctccgccttcagagctgataagattgaccaaggtccccctgacaccagtgcctactaaaatgcagtccctactggagccttctgtaaaaattgaaaccaaagatgtcccgctcaccgtgttgccctcagatgcaggcataccagatactcccttcagtaaggacagaaatggtcatgtgaagcgacccatgaacgcatttatggtttgggcaaggatccaccgaccagcactagccaaagctaacccagcagccaacaatgcagaaatcagtgtccagcttgggttagagtggaacaaacttagtgaagaacaaaagaaaccctattacgatgaagcacaaaagattaaggaaaagcacagagaggaatttcctggttgggtttatcagcctcgtccagggaagcgaaaacgattccctctaagtgtttccaatgtattttctggtaccacaaagaatatcatctctacaaatcctacaacagtttatccttaccgctcacctacgtactctgtggtaattcccagcctacagaatcccatcactcatccagttggtgaaacctcacctgctatccagctgcccacacctgcagtccagagcccaagccctgtcacacttttccagcccagcgtctccagtgctgctcaggtggctgtccaggatccaagtctacctgtctatccagcactcccaccccaacgctttactgggccttcccaaacagacactcatcagctgcattctgaagccactcacactgtgaagcaacccactcctgtctctctagagagcgccaacaggatttcaagtagtgcaagtactgcccatgccagatttgcaacttcgaccatccaacctcctagggagtattccagcgtttccccttgtcccagaagtgctccaatcccccaggcttctcccattccacacccacatgtctaccagccccctccccttggccatccagccacactgttcgggacaccaccaagattctcttttcatcacccttacttcctacccggacctcactacttcccatcaagtacatgcccttacagtcggcctccctttggctatggaaattttccgagttcaatgccagaatgccttagttattatgaagacaggtacccaaaacatgagggtatcttttcaactttaaatagagactattcttttagagactactcaagtgaatgcacacacagtgaaaattctcggagttgtgagaacatgaatggaacttcttactataacagtcatagccacagtggggaagaaaacttaaaccctgtgcctcagctggacattggaaccttggagaatgtcttcacagccccgacatcaactccttctagcatccagcaagtcaatgtcaccgacagtgatgaggaggaagaagaaaaagtgctcagggatttataa
Sequence Length
2262
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,290 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 30, mRNA
NCBI Official Synonym Full Names
SRY-box 30
NCBI Official Symbol
SOX30
NCBI Protein Information
transcription factor SOX-30
UniProt Protein Name
Transcription factor SOX-30
Protein Family
UniProt Gene Name
SOX30
UniProt Entry Name
SOX30_HUMAN
NCBI Description
This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
Uniprot Description
SOX30: Transcriptional activator. Binds to the DNA sequence 5'- ACAAT-3' and shows a preference for guanine residues surrounding this core motif. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding
Chromosomal Location of Human Ortholog: 5q33
Molecular Function: protein binding; sequence-specific DNA binding
Biological Process: response to corticosteroid stimulus
Research Articles on SOX30
Similar Products
Product Notes
The SOX30 sox30 (Catalog #AAA1269768) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagag ccagacccga gccgccgcct cagccgcgcc cgttgcgtcc cgctccgccc ccgctgccgg tcgagggcac ctccttttgg gcagcagcca tggagccccc tccgtcgtct cccacactga gcgcggcagc cagtgcgacc ttggcctcgt cgtgcgggga ggcagtggcg tccggcttac agcccgcggt gcggcggctg ctgcaggtga agccagagca ggtgttgctg ctaccacagc ctcaggccca gaacgaggaa gccgctgcct cgtccgcgca ggcgcggctg ttgcagttca ggcccgacct gcggctcctg cagccgccga cagcgtcaga cggcgccacc tccaggcccg agttgcaccc ggtgcagccc ctggcgctgc atgtcaaggc caagaagcag aagctggggc ccagcctgga tcagtcagtg gggcctcgag gggccgtcga aaccggtcct agagcctcca gggtggtcaa gttggaaggc cccgggccgg ccctcggcta cttccgaggg gacgagaagg gcaagctgga ggcggaggag gtcatgagag actcgatgca aggcggggca ggcaaaagcc cggcagccat ccgagaaggt gtgatcaaaa cggaggaacc cgagagactc ctcgaggact gcaggctcgg cgcggagccc gcgtccaatg gcctggttca tggcagcgcg gaggtcatct tggccccaac gtccggtgcc tttgggccgc accagcaaga ccttaggatc cctttgacgc tccacacggt cccccctggg gcccggatcc agtttcaggg agctccgcct tcagagctga taagattgac caaggtcccc ctgacaccag tgcctactaa aatgcagtcc ctactggagc cttctgtaaa aattgaaacc aaagatgtcc cgctcaccgt gttgccctca gatgcaggca taccagatac tcccttcagt aaggacagaa atggtcatgt gaagcgaccc atgaacgcat ttatggtttg ggcaaggatc caccgaccag cactagccaa agctaaccca gcagccaaca atgcagaaat cagtgtccag cttgggttag agtggaacaa acttagtgaa gaacaaaaga aaccctatta cgatgaagca caaaagatta aggaaaagca cagagaggaa tttcctggtt gggtttatca gcctcgtcca gggaagcgaa aacgattccc tctaagtgtt tccaatgtat tttctggtac cacaaagaat atcatctcta caaatcctac aacagtttat ccttaccgct cacctacgta ctctgtggta attcccagcc tacagaatcc catcactcat ccagttggtg aaacctcacc tgctatccag ctgcccacac ctgcagtcca gagcccaagc cctgtcacac ttttccagcc cagcgtctcc agtgctgctc aggtggctgt ccaggatcca agtctacctg tctatccagc actcccaccc caacgcttta ctgggccttc ccaaacagac actcatcagc tgcattctga agccactcac actgtgaagc aacccactcc tgtctctcta gagagcgcca acaggatttc aagtagtgca agtactgccc atgccagatt tgcaacttcg accatccaac ctcctaggga gtattccagc gtttcccctt gtcccagaag tgctccaatc ccccaggctt ctcccattcc acacccacat gtctaccagc cccctcccct tggccatcca gccacactgt tcgggacacc accaagattc tcttttcatc acccttactt cctacccgga cctcactact tcccatcaag tacatgccct tacagtcggc ctccctttgg ctatggaaat tttccgagtt caatgccaga atgccttagt tattatgaag acaggtaccc aaaacatgag ggtatctttt caactttaaa tagagactat tcttttagag actactcaag tgaatgcaca cacagtgaaa attctcggag ttgtgagaac atgaatggaa cttcttacta taacagtcat agccacagtg gggaagaaaa cttaaaccct gtgcctcagc tggacattgg aaccttggag aatgtcttca cagccccgac atcaactcct tctagcatcc agcaagtcaa tgtcaccgac agtgatgagg aggaagaaga aaaagtgctc agggatttat aa. It is sometimes possible for the material contained within the vial of "SOX30, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
