Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SOX2 cdna clone

SOX2 cDNA Clone

Gene Names
SOX2; ANOP3; MCOPS3
Synonyms
SOX2; SOX2 cDNA Clone; SOX2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacaacatgatggagacggagctgaagccgccgggcccgcagcaaacttcggggggcggcggcggcaactccaccgcggcggcggccggcggcaaccagaaaaacagcccggaccgcgtcaagcggcccatgaatgccttcatggtgtggtcccgcgggcagcggcgcaagatggcccaggagaaccccaagatgcacaactcggagatcagcaagcgcctgggcgccgagtggaaacttttgtcggagacggagaagcggccgttcatcgacgaggctaagcggctgcgagcgctgcacatgaaggagcacccggattataaataccggccccggcggaaaaccaagacgctcatgaagaaggataagtacacgctgcccggcgggctgctggcccccggcggcaatagcatggcgagcggggtcggggtgggcgccggcctgggcgcgggcgtgaaccagcgcatggacagttacgcgcacatgaacggctggagcaacggcagctacagcatgatgcaggaccagctgggctacccgcagcacccgggcctcaatgcgcacggcgcagcgcagatgcagcccatgcaccgctacgacgtgagcgccctgcagtacaactccatgaccagctcgcagacctacatgaacggctcgcccacctacagcatgtcctactcgcagcagggcacccctggcatggctcttggctccatgggttcggtggtcaagtccgaggccagctccagcccccctgtggttacctcttcctcccactccagggcgccctgccaggccggggacctccgggacatgatcagcatgtatctccccggcgccgaggtgccggaacccgccgcccccagcagacttcacatgtcccagcactaccagagcggcccggtgcccggcacggccattaacggcacactgcccctctcacacatgtga
Sequence Length
954
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,310 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 2, mRNA
NCBI Official Synonym Full Names
SRY-box 2
NCBI Official Symbol
SOX2
NCBI Official Synonym Symbols
ANOP3; MCOPS3
NCBI Protein Information
transcription factor SOX-2
UniProt Protein Name
Transcription factor SOX-2
UniProt Gene Name
SOX2
UniProt Entry Name
SOX2_HUMAN

NCBI Description

This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]

Uniprot Description

SOX2: Transcription factor that forms a trimeric complex with OCT4 on DNA and controls the expression of a number of genes involved in embryonic development such as YES1, FGF4, UTF1 and ZFP206. Critical for early embryogenesis and for embryonic stem cell pluripotency. May function as a switch in neuronal development. Downstream SRRT target that mediates the promotion of neural stem cell self-renewal. Keeps neural cells undifferentiated by counteracting the activity of proneural proteins and suppresses neuronal differentiation. Interacts with ZSCAN10. Interacts with SOX3 and FGFR1.

Protein type: Transcription factor; DNA-binding; Cell development/differentiation

Chromosomal Location of Human Ortholog: 3q26.3-q27

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; transcription factor complex

Molecular Function: DNA binding; miRNA binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: cell cycle arrest; endodermal cell fate specification; eye development; forebrain development; inner ear development; negative regulation of epithelial cell proliferation; negative regulation of neuron differentiation; negative regulation of transcription from RNA polymerase II promoter; osteoblast differentiation; pituitary gland development; positive regulation of MAPKKK cascade; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of caspase activity; regulation of gene expression; regulation of transcription, DNA-dependent; response to wounding; somatic stem cell maintenance

Disease: Microphthalmia, Syndromic 3; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on SOX2

Similar Products

Product Notes

The SOX2 sox2 (Catalog #AAA1265781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaaca tgatggagac ggagctgaag ccgccgggcc cgcagcaaac ttcggggggc ggcggcggca actccaccgc ggcggcggcc ggcggcaacc agaaaaacag cccggaccgc gtcaagcggc ccatgaatgc cttcatggtg tggtcccgcg ggcagcggcg caagatggcc caggagaacc ccaagatgca caactcggag atcagcaagc gcctgggcgc cgagtggaaa cttttgtcgg agacggagaa gcggccgttc atcgacgagg ctaagcggct gcgagcgctg cacatgaagg agcacccgga ttataaatac cggccccggc ggaaaaccaa gacgctcatg aagaaggata agtacacgct gcccggcggg ctgctggccc ccggcggcaa tagcatggcg agcggggtcg gggtgggcgc cggcctgggc gcgggcgtga accagcgcat ggacagttac gcgcacatga acggctggag caacggcagc tacagcatga tgcaggacca gctgggctac ccgcagcacc cgggcctcaa tgcgcacggc gcagcgcaga tgcagcccat gcaccgctac gacgtgagcg ccctgcagta caactccatg accagctcgc agacctacat gaacggctcg cccacctaca gcatgtccta ctcgcagcag ggcacccctg gcatggctct tggctccatg ggttcggtgg tcaagtccga ggccagctcc agcccccctg tggttacctc ttcctcccac tccagggcgc cctgccaggc cggggacctc cgggacatga tcagcatgta tctccccggc gccgaggtgc cggaacccgc cgcccccagc agacttcaca tgtcccagca ctaccagagc ggcccggtgc ccggcacggc cattaacggc acactgcccc tctcacacat gtga. It is sometimes possible for the material contained within the vial of "SOX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.