SORBS1 cdna clone
SORBS1 cDNA Clone
Gene Names
SORBS1; CAP; FLAF2; R85FL; SH3D5; SORB1; SH3P12
Synonyms
SORBS1; SORBS1 cDNA Clone; SORBS1 cdna clone
Sequence
atgagttctgaatgtgatggtggttccaaagctgtgatgaatggcttggcacctggcagcaatgggcaagacaaagacatggatcctacaaaaatctgcactgggaagggagcggtgactctccgggcctcgtcttcctacagggaaaccccaagcagtagccctgcgagccctcaggaaacccggcaacacgaaagcaaaccagatgagtggaggctttcttccagtgctgatgccaatggaaatgcccagccctcttcactcgctgccaagggctacagaagtgtgcatcccaaccttccttctgacaagtcccaggatgccacttcctccagtgcagcccagccggaggtaatagttgtccctctctacctggttaatactgacagagggcaagaaggcactgccagacctccaacacctctggggcctcttggctgcgtccccacaatcccagcgactgcctctgccgcctcacctctgaccttcccgactctagatgatttcattccccctcatctgcagaggtggccccaccacagccagccagcccgcgcctctggctcctttgcccccattagccagacgccaccatccttctcaccaccacctccgctggtccctcctgccccggaggacctccgcagagtctcggagcctgacctcacgggagctgtttcgagtaccgattccagtcctctactaaatgaagtttcttcttcccttattggaactgattcccaagcctttccatcagttagcaagccttcatccgcctatccctccacaacgattgtcaatcctactattgtgctcttgcaacacaatcgagaacagcaaaaacgactcagtagcctttcagatcctgtctcagaaagaagagtgggagagcaggactcagcaccaacccaggaaaaacccacctcacctggcaaggctattgaaaaaagagcaaaggatgacagtaggcgggtggtgaagagcactcaggacttaagcgatgtttccatggatgaagtgggcatcccactccggaacactgagagatcaaaagactggtacaagactatgtttaaacagatccacaaactgaacagagatgatgattcagatctgtactctcccagatactcattttctgaagacacaaaatctcccctttctgtgcctcgctcaaaaagtgagatgagctacattgatggtgagaaggtagtcaagaggtcggccacactacccctcccagcccgctcttcctcactgaagtcaagctcagaaagaaatgactgggaacccccagataagaaagtagacacaagaaaatatcgtgcagagcccaagagcatttacgaatatcagcctggcaagtcttccgttctgaccaacgaaaagatgagctcagccatcagccctactccggaaatttcttcagagactcctggatatatatattcttccaacttccatgcagtgaagagggaatcagacggggctcctggggatctcactagcttggagaatgagagacaaatttataaaagtgtcttggaaggtggtgacatccctcttcagggcctgagtgggctcaagcgaccatccagctctgcttccactaaagattcagaatcgccaagacattttataccagctgattacttggaatccacggaagaatttattcgaagacgtcatgatgataaagagaaacttttagcggaccagagacgacttaaacgcgagcaagaagaggctgatattgcagctcgacgccacacaggcgtcattccgacgcaccatcagtttatcactaatgagcgctttggggacctcctcaatatagacgatactgcaaaaaggaaatctgggtcagagaaatatgactgggcatag
Sequence Length
1887
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
143,741 Da
NCBI Official Full Name
Homo sapiens sorbin and SH3 domain containing 1, mRNA
NCBI Official Synonym Full Names
sorbin and SH3 domain containing 1
NCBI Official Symbol
SORBS1
NCBI Official Synonym Symbols
CAP; FLAF2; R85FL; SH3D5; SORB1; SH3P12
NCBI Protein Information
sorbin and SH3 domain-containing protein 1
UniProt Protein Name
Sorbin and SH3 domain-containing protein 1
Protein Family
UniProt Gene Name
SORBS1
UniProt Synonym Gene Names
CAP
UniProt Entry Name
SRBS1_HUMAN
NCBI Description
This gene encodes a CBL-associated protein which functions in the signaling and stimulation of insulin. Mutations in this gene may be associated with human disorders of insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Uniprot Description
SORBS1: Plays a role in tyrosine phosphorylation of CBL by linking CBL to the insulin receptor. Required for insulin- stimulated glucose transport. Involved in formation of actin stress fibers and focal adhesions. 12 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell adhesion; Cytoskeletal; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 10q23.33
Cellular Component: cell-cell adherens junction; cell-substrate adherens junction; centrosome; cytoplasm; cytosol; focal adhesion; lipid raft; nucleoplasm; nucleus; plasma membrane; stress fiber; zonula adherens
Molecular Function: actin binding; cytoskeletal protein binding; insulin receptor binding; protein binding; SH3/SH2 adaptor activity
Biological Process: cell-matrix adhesion; cellular response to insulin stimulus; focal adhesion formation; glucose transport; insulin receptor signaling pathway; muscle contraction; positive regulation of glucose import; positive regulation of glycogen biosynthetic process; positive regulation of lipid biosynthetic process; stress fiber formation
Research Articles on SORBS1
Similar Products
Product Notes
The SORBS1 sorbs1 (Catalog #AAA1276219) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttctg aatgtgatgg tggttccaaa gctgtgatga atggcttggc acctggcagc aatgggcaag acaaagacat ggatcctaca aaaatctgca ctgggaaggg agcggtgact ctccgggcct cgtcttccta cagggaaacc ccaagcagta gccctgcgag ccctcaggaa acccggcaac acgaaagcaa accagatgag tggaggcttt cttccagtgc tgatgccaat ggaaatgccc agccctcttc actcgctgcc aagggctaca gaagtgtgca tcccaacctt ccttctgaca agtcccagga tgccacttcc tccagtgcag cccagccgga ggtaatagtt gtccctctct acctggttaa tactgacaga gggcaagaag gcactgccag acctccaaca cctctggggc ctcttggctg cgtccccaca atcccagcga ctgcctctgc cgcctcacct ctgaccttcc cgactctaga tgatttcatt ccccctcatc tgcagaggtg gccccaccac agccagccag cccgcgcctc tggctccttt gcccccatta gccagacgcc accatccttc tcaccaccac ctccgctggt ccctcctgcc ccggaggacc tccgcagagt ctcggagcct gacctcacgg gagctgtttc gagtaccgat tccagtcctc tactaaatga agtttcttct tcccttattg gaactgattc ccaagccttt ccatcagtta gcaagccttc atccgcctat ccctccacaa cgattgtcaa tcctactatt gtgctcttgc aacacaatcg agaacagcaa aaacgactca gtagcctttc agatcctgtc tcagaaagaa gagtgggaga gcaggactca gcaccaaccc aggaaaaacc cacctcacct ggcaaggcta ttgaaaaaag agcaaaggat gacagtaggc gggtggtgaa gagcactcag gacttaagcg atgtttccat ggatgaagtg ggcatcccac tccggaacac tgagagatca aaagactggt acaagactat gtttaaacag atccacaaac tgaacagaga tgatgattca gatctgtact ctcccagata ctcattttct gaagacacaa aatctcccct ttctgtgcct cgctcaaaaa gtgagatgag ctacattgat ggtgagaagg tagtcaagag gtcggccaca ctacccctcc cagcccgctc ttcctcactg aagtcaagct cagaaagaaa tgactgggaa cccccagata agaaagtaga cacaagaaaa tatcgtgcag agcccaagag catttacgaa tatcagcctg gcaagtcttc cgttctgacc aacgaaaaga tgagctcagc catcagccct actccggaaa tttcttcaga gactcctgga tatatatatt cttccaactt ccatgcagtg aagagggaat cagacggggc tcctggggat ctcactagct tggagaatga gagacaaatt tataaaagtg tcttggaagg tggtgacatc cctcttcagg gcctgagtgg gctcaagcga ccatccagct ctgcttccac taaagattca gaatcgccaa gacattttat accagctgat tacttggaat ccacggaaga atttattcga agacgtcatg atgataaaga gaaactttta gcggaccaga gacgacttaa acgcgagcaa gaagaggctg atattgcagc tcgacgccac acaggcgtca ttccgacgca ccatcagttt atcactaatg agcgctttgg ggacctcctc aatatagacg atactgcaaa aaggaaatct gggtcagaga aatatgactg ggcatag. It is sometimes possible for the material contained within the vial of "SORBS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
