Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNUPN cdna clone

SNUPN cDNA Clone

Gene Names
SNUPN; KPNBL; RNUT1; Snurportin1
Synonyms
SNUPN; SNUPN cDNA Clone; SNUPN cdna clone
Ordering
For Research Use Only!
Sequence
atggaagagttgagtcaggccctggctagtagcttttctgtgtctcaagatctgaacagcacagctgccccacacccccgcctatcccagtacaagtccaagtacagttccttggagcagagtgagcgccgccggaggttactggaactgcagaaatccaagcggctggattatgtgaaccatgccagaagactggctgaagatgactggacagggatggagagtgaggaagaaaataagaaagatgatgaagaaatggacattgacactgtcaagaagttaccaaaacactatgctaatcaattgatgctttctgagtggttaattgacgttccttcagatttggggcaggaatggattgtggtcgtgtgccctgttggaaaaagagcccttatcgtggcctccaggggttctaccagtgcctacaccaagagtggctactgtgtcaacaggttttcttcacttctgccaggaggcaacaggcgaaactcaacagcaaaagactacaccattctagattgcatttacaatgaggtaaaccagacctactacgttctggatgtgatgtgctggcggggacaccctttttatgattgccagactgatttccgattctactggatgcattcaaagttaccagaagaagaaggactgggagagaaaaccaagcttaatccttttaaatttgtggggctaaagaacttcccttgcactcccgaaagcctgtgtgatgtgctatctatggatttcccttttgaggtagatggacttctcttctaccacaaacagacccactacagccccggaagcactcccttggtgggctggctgcgcccctacatggtgtcagatgtccttggtgtagctgtgccggctggcccgctgaccaccaagccagactatgctgggcaccagctccagcagattatggagcacaagaagagccagaaggaaggcatgaaggagaaactcacacacaaggcctctgagaatgggcactatgaattggagcacctgtctactcccaagttgaagggttcttcccatagcccagaccaccctggatgcctcatggagaattaa
Sequence Length
1083
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,143 Da
NCBI Official Full Name
Homo sapiens snurportin 1, mRNA
NCBI Official Synonym Full Names
snurportin 1
NCBI Official Symbol
SNUPN
NCBI Official Synonym Symbols
KPNBL; RNUT1; Snurportin1
NCBI Protein Information
snurportin-1
UniProt Protein Name
Snurportin-1
UniProt Gene Name
SNUPN
UniProt Synonym Gene Names
RNUT1; SPN1
UniProt Entry Name
SPN1_HUMAN

NCBI Description

The nuclear import of the spliceosomal snRNPs U1, U2, U4 and U5, is dependent on the presence of a complex nuclear localization signal. The latter is composed of the 5'-2,2,7-terminal trimethylguanosine (m3G) cap structure of the U snRNA and the Sm core domain. The protein encoded by this gene interacts specifically with m3G-cap and functions as an snRNP-specific nuclear import receptor. Alternatively spliced transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RNUT1: Functions as an U snRNP-specific nuclear import adapter. Involved in the trimethylguanosine (m3G)-cap-dependent nuclear import of U snRNPs. Binds specifically to the terminal m3G-cap U snRNAs. Belongs to the snurportin family.

Protein type: RNA-binding; Nuclear import

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: cytosol; nuclear pore

Molecular Function: RNA cap binding

Biological Process: nuclear import; spliceosomal snRNP biogenesis

Research Articles on SNUPN

Similar Products

Product Notes

The SNUPN snupn (Catalog #AAA1277243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagagt tgagtcaggc cctggctagt agcttttctg tgtctcaaga tctgaacagc acagctgccc cacacccccg cctatcccag tacaagtcca agtacagttc cttggagcag agtgagcgcc gccggaggtt actggaactg cagaaatcca agcggctgga ttatgtgaac catgccagaa gactggctga agatgactgg acagggatgg agagtgagga agaaaataag aaagatgatg aagaaatgga cattgacact gtcaagaagt taccaaaaca ctatgctaat caattgatgc tttctgagtg gttaattgac gttccttcag atttggggca ggaatggatt gtggtcgtgt gccctgttgg aaaaagagcc cttatcgtgg cctccagggg ttctaccagt gcctacacca agagtggcta ctgtgtcaac aggttttctt cacttctgcc aggaggcaac aggcgaaact caacagcaaa agactacacc attctagatt gcatttacaa tgaggtaaac cagacctact acgttctgga tgtgatgtgc tggcggggac acccttttta tgattgccag actgatttcc gattctactg gatgcattca aagttaccag aagaagaagg actgggagag aaaaccaagc ttaatccttt taaatttgtg gggctaaaga acttcccttg cactcccgaa agcctgtgtg atgtgctatc tatggatttc ccttttgagg tagatggact tctcttctac cacaaacaga cccactacag ccccggaagc actcccttgg tgggctggct gcgcccctac atggtgtcag atgtccttgg tgtagctgtg ccggctggcc cgctgaccac caagccagac tatgctgggc accagctcca gcagattatg gagcacaaga agagccagaa ggaaggcatg aaggagaaac tcacacacaa ggcctctgag aatgggcact atgaattgga gcacctgtct actcccaagt tgaagggttc ttcccatagc ccagaccacc ctggatgcct catggagaat taa. It is sometimes possible for the material contained within the vial of "SNUPN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.