SNRPE cdna clone

SNRPE

Cat. Num. AAA200712

• Gene Names: SNRPE; SME; Sm-E; HYPT11; snRNP-E
• Synonyms: SNRPE; B-raf; HYPT11; Sm-E; SME; SNRPE cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGCGTACCGTGGCCAGGGTCAGAAAGTGCAGAAGGTTATGGTGCAGCCCATCAACCTCATCTTCAGATACTTACAAAATAGATCGCGGATTCAGGTGTGGCTCTATGAGCAAGTGAATATGCGGATAGAAGGCTGTATCATTGGTTTTGATGAGTATATGAACCTTGTATTAGATGATGCAGAAGAGATTCATTCTAAAACAAAGTCAAGAAAACAACTGGGTCGGATCATGCTAAAAGGAGATAATATTACTCTGCTACAAAGTGTCTCCAACTAG; ; Translation Sequence: MAYRGQGQKV QKVMVQPINL IFRYLQNRSR IQVWLYEQVN MRIEGCIIGF DEYMNLVLDDAEEIHSKTKS RKQLGRIMLK GDNITLLQSV SN
• Sequence Length: 92

• Species: Human
• Chromosome Location: 1q32
• OMIM Reference Number: 128260
• cDNA Size: 279bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for SNRPE cdna clone

Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in an heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. As part of the U7 snRNP it is involved in histone 3-end processing. May indirectly play a role in hair development.

NCBI and Uniprot Product Information

• NCBI GI #: 4507129
• NCBI GeneID: 6635
• NCBI Accession #: NP_003085.1
• NCBI GenBank Nucleotide #: NM_003094.3
• UniProt Accession #: P62304
• NCBI Official Full Name: small nuclear ribonucleoprotein E isoform 1
• NCBI Official Synonym Full Names: small nuclear ribonucleoprotein polypeptide E
• NCBI Official Symbol: SNRPE
• NCBI Official Synonym Symbols: SME; Sm-E; HYPT11; snRNP-E
• NCBI Protein Information: small nuclear ribonucleoprotein E
• UniProt Protein Name: Small nuclear ribonucleoprotein E
• Protein Family: Small nuclear ribonucleoprotein
• UniProt Gene Name: SNRPE
• UniProt Synonym Gene Names: snRNP-E; Sm-E; SmE
• UniProt Entry Name: RUXE_HUMAN

NCBI Description

The protein encoded by this gene is a core component of U small nuclear ribonucleoproteins, which are key components of the pre-mRNA processing spliceosome. The encoded protein plays a role in the 3' end processing of histone transcripts. This protein is one of the targets in the autoimmune disease systemic lupus erythematosus, and mutations in this gene have been associated with hypotrichosis. Several pseudogenes of this gene have been identified. [provided by RefSeq, Jun 2016]

Uniprot Description

snRNP E: Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing. Associated with snRNP U1, U2, U4/U6 and U5. Belongs to the snRNP Sm proteins family.

Protein type: RNA splicing; Spliceosome

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: nucleoplasm; small nuclear ribonucleoprotein complex; spliceosome; U4/U6 x U5 tri-snRNP complex; snRNP U5; snRNP U2; snRNP U1; nucleus; cytosol; U12-dependent spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: transcription from RNA polymerase II promoter; nuclear mRNA splicing, via spliceosome; spliceosomal snRNP biogenesis; RNA splicing; spliceosome assembly; histone mRNA metabolic process; gene expression; mRNA 3'-end processing; termination of RNA polymerase II transcription; hair cycle

Disease: Hypotrichosis 11