Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRNP35 cdna clone

SNRNP35 cDNA Clone

Gene Names
SNRNP35; HM-1; U1SNRNPBP
Synonyms
SNRNP35; SNRNP35 cDNA Clone; SNRNP35 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaccagctaacatgaacgattggatgcccatcgccaaggagtatgatccactcaaagcgggcagcattgatggcaccgatgaagacccacacgaccgcgcggtctggagggcaatgctggcacgatatgtccccaacaaaggtgtcataggagatcccctcctcaccctgtttgtggccagactaaacttgcagaccaaggaggacaaattaaaggaagtcttttcccgctatggtgacatccggcggcttcggctggtcagggacttggtcacaggtttttcaaagggctacgccttcatcgaatacaaggaggagcgtgccgtgatcaaagcttaccgagatgctgatggcctggttattgaccagcatgagatatttgtggactacgagctggaaaggactctcaaagggtggatccctcggcgacttggaggcggtcttgggggaaaaaaggagtctgggcaactgagatttgggggacgggaccggccttttcgaaaacctattaacttgccagttgttaaaaacgacctctatagagagggaaaacgggaaaggcgggagcgatctcgatcccgagaaagacactgggactcgaggacaagggatcgagaccatgacaggggccgggagaagagatggcaagaaagagagccgaccagggtgtggcccgacaatgactgggagagagagagggacttcagagatgacaggatcaaggggagggagaagaaggaaagaggcaagtag
Sequence Length
756
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,992 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein 35kDa (U11/U12), mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein U11/U12 subunit 35
NCBI Official Symbol
SNRNP35
NCBI Official Synonym Symbols
HM-1; U1SNRNPBP
NCBI Protein Information
U11/U12 small nuclear ribonucleoprotein 35 kDa protein
UniProt Protein Name
U11/U12 small nuclear ribonucleoprotein 35 kDa protein
UniProt Gene Name
SNRNP35
UniProt Synonym Gene Names
HM1; U1SNRNPBP; U11/U12 snRNP 35 kDa protein; U11/U12-35K
UniProt Entry Name
U1SBP_HUMAN

NCBI Description

The protein encoded by this gene is a homolog of the U1-snRNP binding protein. The N-terminal half contains a RNA recognition motif and the C-terminal half is rich in Arg/Asp and Arg/Glu dipeptides, which is a characteristic of a variety of splicing factors. This protein is a component of the U11/U12 small nuclear ribonucleoproteins (snRNP) that form part of the U12-type spliceosome. Alternative splicing results in multiple transcript variants encoding two distinct isoforms and representing a non-protein coding variant. [provided by RefSeq, Aug 2013]

Uniprot Description

U1SNRNPBP: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: nucleoplasm; nucleus; U12-dependent spliceosome

Molecular Function: mRNA binding; snRNA binding

Biological Process: nuclear mRNA splicing, via spliceosome; RNA splicing

Research Articles on SNRNP35

Similar Products

Product Notes

The SNRNP35 snrnp35 (Catalog #AAA1278825) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaccag ctaacatgaa cgattggatg cccatcgcca aggagtatga tccactcaaa gcgggcagca ttgatggcac cgatgaagac ccacacgacc gcgcggtctg gagggcaatg ctggcacgat atgtccccaa caaaggtgtc ataggagatc ccctcctcac cctgtttgtg gccagactaa acttgcagac caaggaggac aaattaaagg aagtcttttc ccgctatggt gacatccggc ggcttcggct ggtcagggac ttggtcacag gtttttcaaa gggctacgcc ttcatcgaat acaaggagga gcgtgccgtg atcaaagctt accgagatgc tgatggcctg gttattgacc agcatgagat atttgtggac tacgagctgg aaaggactct caaagggtgg atccctcggc gacttggagg cggtcttggg ggaaaaaagg agtctgggca actgagattt gggggacggg accggccttt tcgaaaacct attaacttgc cagttgttaa aaacgacctc tatagagagg gaaaacggga aaggcgggag cgatctcgat cccgagaaag acactgggac tcgaggacaa gggatcgaga ccatgacagg ggccgggaga agagatggca agaaagagag ccgaccaggg tgtggcccga caatgactgg gagagagaga gggacttcag agatgacagg atcaagggga gggagaagaa ggaaagaggc aagtag. It is sometimes possible for the material contained within the vial of "SNRNP35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.