Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRNP27 cdna clone

SNRNP27 cDNA Clone

Gene Names
SNRNP27; 27K; RY1
Synonyms
SNRNP27; SNRNP27 cDNA Clone; SNRNP27 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtcgcagtcgcagccgctctccacggagggaacgtaggcgttcccggtccacatcccgggagagagaacgcaggcgccgagaaaggtccaggtctcgggagagagatcggagaaggagccgctcgcgatccccgcaccgaagacgctcccgatctccaagacgacatagatccacatctccttccccttctcgactgaaagaaagaagagatgaggaaaagaaagaaacaaaagaaacaaagagcaaagaacggcagattactgaggaagacttagagggcaaaacagaggaagaaatagaaatgatgaagttaatgggatttgcctcctttgactccacaaaaggtaagaaggtggatggctctgtaaatgcctatgccataaatgtctctcagaagaggaagtacaggcagtacatgaatcgaaaaggtggattcaacagacctttggatttcattgcatga
Sequence Length
468
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,860 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein 27kDa (U4/U6.U5), mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein U4/U6.U5 subunit 27
NCBI Official Symbol
SNRNP27
NCBI Official Synonym Symbols
27K; RY1
NCBI Protein Information
U4/U6.U5 small nuclear ribonucleoprotein 27 kDa protein
UniProt Protein Name
U4/U6.U5 small nuclear ribonucleoprotein 27 kDa protein
UniProt Gene Name
SNRNP27
UniProt Synonym Gene Names
U4/U6.U5 snRNP 27 kDa protein; U4/U6.U5-27K; 27K
UniProt Entry Name
SNR27_HUMAN

NCBI Description

This gene encodes a serine/arginine-rich (SR) protein. SR proteins play important roles in pre-mRNA splicing by facilitating the recognition and selection of splice sites. The encoded protein associates with the 25S U4/U6.U5 tri-snRNP, a major component of the U2-type spiceosome. The expression of this gene may be altered in cells infected with the human T-cell lymphotropic virus type 1 (HTLV-1) retrovirus. A pseudogene of this gene is located on the long arm of chromosome 5. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]

Uniprot Description

RY1: a putative nucleic acid binding protein. May play a role in mRNA splicing. Part of a tri-snRNP complex.

Protein type: Spliceosome

Chromosomal Location of Human Ortholog: 2p13.3

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: nuclear mRNA splicing, via spliceosome

Similar Products

Product Notes

The SNRNP27 snrnp27 (Catalog #AAA1266321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcgca gtcgcagccg ctctccacgg agggaacgta ggcgttcccg gtccacatcc cgggagagag aacgcaggcg ccgagaaagg tccaggtctc gggagagaga tcggagaagg agccgctcgc gatccccgca ccgaagacgc tcccgatctc caagacgaca tagatccaca tctccttccc cttctcgact gaaagaaaga agagatgagg aaaagaaaga aacaaaagaa acaaagagca aagaacggca gattactgag gaagacttag agggcaaaac agaggaagaa atagaaatga tgaagttaat gggatttgcc tcctttgact ccacaaaagg taagaaggtg gatggctctg taaatgccta tgccataaat gtctctcaga agaggaagta caggcagtac atgaatcgaa aaggtggatt caacagacct ttggatttca ttgcatga. It is sometimes possible for the material contained within the vial of "SNRNP27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.