Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAPC3 cdna clone

SNAPC3 cDNA Clone

Gene Names
SNAPC3; SNAP50; PTFbeta
Synonyms
SNAPC3; SNAPC3 cDNA Clone; SNAPC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgaaggaagccgaggtggccctacgtgtagcggggtgggtggcaggcaggacccagtctccggcagtggcggctgcaactttccagagtatgagcttcccgagctaaatacgcgcgctttccatgtgggcgcctttggggagctgtggcggggccgtctgcgcggggccggggacttgtcgctgagggagccgccggcatccgctctgcctgggagccaggcagctgactccgaccgggaggatgccgcggtggccagggatctggactgcagcctggaggcggcggctgagctgagggcggtgtgcggccttgataaactgaaatgccttgaggacggtgaggatccagaagtcattccggagaatactgacctggtgactttgggggttagaaaaaggttcttggaacatcgggaagaaaccattacaatagatcgagcctgcagacaagaaacattcgtttatgagatggagtcacatgccataggaaaaaagcctgaaaattcagcagacatgattgaagaaggggagcttatcctatctgtgaatatcttgtaccctgttatatttcataagcacaaagaacacaaaccataccaaacaatgctggtgttgggcagtcaaaaactcacacaactgagggattcaattcgatgtgtcagtgacctccagattggtggtgaattcagcaacactcctgaccaagcccctgagcacatcagcaaagacctatacaaatcagccttctttttttga
Sequence Length
762
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,753 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:5272943, containing frame-shift errors
NCBI Official Synonym Full Names
small nuclear RNA activating complex polypeptide 3
NCBI Official Symbol
SNAPC3
NCBI Official Synonym Symbols
SNAP50; PTFbeta
NCBI Protein Information
snRNA-activating protein complex subunit 3
UniProt Protein Name
snRNA-activating protein complex subunit 3
UniProt Gene Name
SNAPC3
UniProt Synonym Gene Names
SNAP50; SNAPc subunit 3; PSE-binding factor subunit beta; PTF subunit beta; SNAPc 50 kDa subunit
UniProt Entry Name
SNPC3_HUMAN

Uniprot Description

SNAPC3: Part of the SNAPc complex required for the transcription of both RNA polymerase II and III small-nuclear RNA genes. Binds to the proximal sequence element (PSE), a non-TATA-box basal promoter element common to these 2 types of genes. Recruits TBP and BRF2 to the U6 snRNA TATA box.

Protein type: Transcription factor

Chromosomal Location of Human Ortholog: 9p22.3

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: snRNA transcription; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter; transcription from RNA polymerase III promoter

Research Articles on SNAPC3

Similar Products

Product Notes

The SNAPC3 snapc3 (Catalog #AAA1271560) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgaag gaagccgagg tggccctacg tgtagcgggg tgggtggcag gcaggaccca gtctccggca gtggcggctg caactttcca gagtatgagc ttcccgagct aaatacgcgc gctttccatg tgggcgcctt tggggagctg tggcggggcc gtctgcgcgg ggccggggac ttgtcgctga gggagccgcc ggcatccgct ctgcctggga gccaggcagc tgactccgac cgggaggatg ccgcggtggc cagggatctg gactgcagcc tggaggcggc ggctgagctg agggcggtgt gcggccttga taaactgaaa tgccttgagg acggtgagga tccagaagtc attccggaga atactgacct ggtgactttg ggggttagaa aaaggttctt ggaacatcgg gaagaaacca ttacaataga tcgagcctgc agacaagaaa cattcgttta tgagatggag tcacatgcca taggaaaaaa gcctgaaaat tcagcagaca tgattgaaga aggggagctt atcctatctg tgaatatctt gtaccctgtt atatttcata agcacaaaga acacaaacca taccaaacaa tgctggtgtt gggcagtcaa aaactcacac aactgaggga ttcaattcga tgtgtcagtg acctccagat tggtggtgaa ttcagcaaca ctcctgacca agcccctgag cacatcagca aagacctata caaatcagcc ttcttttttt ga. It is sometimes possible for the material contained within the vial of "SNAPC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.