Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAPC2 cdna clone

SNAPC2 cDNA Clone

Gene Names
SNAPC2; SNAP45; PTFDELTA
Synonyms
SNAPC2; SNAPC2 cDNA Clone; SNAPC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagccacctcccaggcggcgagcggccccggcgcgctatctgggcgaggtgaccggtcccgcgacctggagcgctcgcgagaagcggcagctagtgcgactcctgcaggcgcggcagggccagccggagccggacgccaccgagctggcccgggagctgcggggccggagcgaggctgagatccgggtcttcctccagcagctcaagggccgcgtagcccgggaggccattcagaaagtgcatccgggtggccttcagggaccaaggcgccgggaggcacagcccccagcccccatagaggtctggacggatctggctgagaagataacagggccactggaagaagccctggcagtggctttctcgcaggtgctcaccatcgcggccacggaaccggtcaccctcctgcactccaagccccccaagcccacgcaggcccgtggaaagcctttgctcctgagcgcccctggaggacaggaagaccccgcccctgaaatacctagctctgcccctgctgcacctagctccgcacccaggactcctgaccctgcccctgagaaaccttctgagtcgtcggctggtccctccactgaagaagactttgctgtggactttgagaagatctacaagtacttgtcctctgtctcccgaagtggccgcagccccgagctctcagcagctgagtccgctgtggtcctcgacctgctcatgtcacttccagaggagctgccactcctgccctgcacagccctggttgagcatatgacggagacgtacctacgcctgacagccccccagcccattcccgctggagggagcctggggcctgcagcagaaggggatggggctggctccaaggcaccagaggagacccccccagccaccgagaaggccgagcacagcgaactgaaatcgccttggcaagcagctgggatctgtcccctgaacccgttcctggtgcccctggagcttctgggtcgggcagccacccctgccaggtga
Sequence Length
1005
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,556 Da
NCBI Official Full Name
Homo sapiens small nuclear RNA activating complex, polypeptide 2, 45kDa, mRNA
NCBI Official Synonym Full Names
small nuclear RNA activating complex polypeptide 2
NCBI Official Symbol
SNAPC2
NCBI Official Synonym Symbols
SNAP45; PTFDELTA
NCBI Protein Information
snRNA-activating protein complex subunit 2
UniProt Protein Name
snRNA-activating protein complex subunit 2
UniProt Gene Name
SNAPC2
UniProt Synonym Gene Names
SNAP45; SNAPc subunit 2; PSE-binding factor subunit delta; PTF subunit delta; SNAPc 45 kDa subunit
UniProt Entry Name
SNPC2_HUMAN

NCBI Description

This gene encodes a subunit of the snRNA-activating protein complex which is associated with the TATA box-binding protein. The encoded protein is necessary for RNA polymerase II and III dependent small-nuclear RNA gene transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]

Uniprot Description

SNAPC2: Part of the SNAPc complex required for the transcription of both RNA polymerase II and III small-nuclear RNA genes. Binds to the proximal sequence element (PSE), a non-TATA-box basal promoter element common to these 2 types of genes. Recruits TBP and BRF2 to the U6 snRNA TATA box.

Chromosomal Location of Human Ortholog: 19p13

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: transcription factor activity

Biological Process: snRNA transcription; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter; transcription from RNA polymerase III promoter

Research Articles on SNAPC2

Similar Products

Product Notes

The SNAPC2 snapc2 (Catalog #AAA1275990) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccac ctcccaggcg gcgagcggcc ccggcgcgct atctgggcga ggtgaccggt cccgcgacct ggagcgctcg cgagaagcgg cagctagtgc gactcctgca ggcgcggcag ggccagccgg agccggacgc caccgagctg gcccgggagc tgcggggccg gagcgaggct gagatccggg tcttcctcca gcagctcaag ggccgcgtag cccgggaggc cattcagaaa gtgcatccgg gtggccttca gggaccaagg cgccgggagg cacagccccc agcccccata gaggtctgga cggatctggc tgagaagata acagggccac tggaagaagc cctggcagtg gctttctcgc aggtgctcac catcgcggcc acggaaccgg tcaccctcct gcactccaag ccccccaagc ccacgcaggc ccgtggaaag cctttgctcc tgagcgcccc tggaggacag gaagaccccg cccctgaaat acctagctct gcccctgctg cacctagctc cgcacccagg actcctgacc ctgcccctga gaaaccttct gagtcgtcgg ctggtccctc cactgaagaa gactttgctg tggactttga gaagatctac aagtacttgt cctctgtctc ccgaagtggc cgcagccccg agctctcagc agctgagtcc gctgtggtcc tcgacctgct catgtcactt ccagaggagc tgccactcct gccctgcaca gccctggttg agcatatgac ggagacgtac ctacgcctga cagcccccca gcccattccc gctggaggga gcctggggcc tgcagcagaa ggggatgggg ctggctccaa ggcaccagag gagacccccc cagccaccga gaaggccgag cacagcgaac tgaaatcgcc ttggcaagca gctgggatct gtcccctgaa cccgttcctg gtgcccctgg agcttctggg tcgggcagcc acccctgcca ggtga. It is sometimes possible for the material contained within the vial of "SNAPC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.