Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAP91 cdna clone

SNAP91 cDNA Clone

Gene Names
SNAP91; CALM; AP180
Synonyms
SNAP91; SNAP91 cDNA Clone; SNAP91 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggacgaacgctcacggatcggatcgccgccgctcagtacagcgttacaggctctgctgtagcaagagcggtctgcaaagccactactcatgaagtaatgggccccaagaaaaagcacctggactatttgatccaggctaccaacgagaccaatgttaatattcctcagatggccgacactctctttgagcgggcaacaaacagtagctgggtggttgtgtttaaggctttagtgacaacacatcatctcatggtgcatggaaatgagagatttattcaatatttggcttctagaaatacactattcaatctcagcaattttttggacaaaagtggatcccatggttatgatatgtctaccttcataaggcgctatagtagatatttgaatgaaaaggctttttcttacagacagatggcctttgattttgccagggtgaagaaaggggccgatggtgtaatgaggacaatggctcccgaaaagctgctaaagagtatgccaatactacagggacaaattgatgcactgcttgaatttgatgtgcatccaaatgaactaacaaatggtgtcataaatgcagcatttatgcttcttttcaaagatcttatcaaactttttgcttgctacaatgatggtgttattaacttactcgaaaagttttttgaaatgaagaaaggacaatgtaaagatgctctagaaatttacaaacgatttctaactagaatgacacgagtgtctgaatttctcaaggttgcagaggctcccagcagtcttatggagacgcttgaacagcatctaaatacattagaaggaaagaaacctggaaacaaatctggtgctccctctccattaagtaagtcttctccagccacaactgttacgtctcctaattctacaccagctaaaactattgacacatccccaccggttgatttatttgcaactgcatctgcggctgtcccagtcagcacttctaaaccatctagtgatctcctggacctccagccagacttttcctctggaggggcagcagcagccgcagcaccagcaccaccaccacctgctggaggagccactgcatggggaggatttgggggttctttcatggcgccttccccatctccagtgactccagctcagaataacctgctacagcccaattttgaggcagcttttgggacaacgccttcaacttccagcagcagctcctttgatccatcagtgtttgatggtctaggtgatcttttgatgccaaccatggcaccagctgggcagcctgcacctgtctcaatggtaccacccagtcctgcaatggcagccagcaaagcccttggaagtgatcttgattcatctcttgccagcttagtaggcaatcttggaatttctggtaccacaacaaaaaagggagatcttcagtggaatgctggagagaaaaagttgactggtggagccaactggcagcctaaagtagctccagcaacctggtcagcaggcgttccaccaagtgcacctttgcaaggagctgtacctccaaccagttcagttcctcctgttgccggggccccatcggttggacaacctggagcaggatttggaatgcctcctgctgggacaggcatgcccatgatgcctcagcagccggtcatgtttgcacagcccatgatgaggcccccctttggagctgccgctgtacctggcacgcagctttctccaagccctacacctgccagtcagagtcccaagaaacctccagcaaaggacccattagcggatcttaacatcaaggatttcttgtaa
Sequence Length
1803
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,656 Da
NCBI Official Full Name
Homo sapiens synaptosomal-associated protein, 91kDa homolog (mouse), mRNA
NCBI Official Synonym Full Names
synaptosome associated protein 91
NCBI Official Symbol
SNAP91
NCBI Official Synonym Symbols
CALM; AP180
NCBI Protein Information
clathrin coat assembly protein AP180
UniProt Protein Name
Clathrin coat assembly protein AP180
UniProt Gene Name
SNAP91
UniProt Synonym Gene Names
KIAA0656
UniProt Entry Name
AP180_HUMAN

Uniprot Description

SNAP-91: Adaptins are components of the adapter complexes which link clathrin to receptors in coated vesicles. Clathrin-associated protein complexes are believed to interact with the cytoplasmic tails of membrane proteins, leading to their selection and concentration. Binding of AP180 to clathrin triskelia induces their assembly into 60-70 nm coats. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 6q14.2

Molecular Function: protein binding; protein kinase binding

Research Articles on SNAP91

Similar Products

Product Notes

The SNAP91 snap91 (Catalog #AAA1278399) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggac gaacgctcac ggatcggatc gccgccgctc agtacagcgt tacaggctct gctgtagcaa gagcggtctg caaagccact actcatgaag taatgggccc caagaaaaag cacctggact atttgatcca ggctaccaac gagaccaatg ttaatattcc tcagatggcc gacactctct ttgagcgggc aacaaacagt agctgggtgg ttgtgtttaa ggctttagtg acaacacatc atctcatggt gcatggaaat gagagattta ttcaatattt ggcttctaga aatacactat tcaatctcag caattttttg gacaaaagtg gatcccatgg ttatgatatg tctaccttca taaggcgcta tagtagatat ttgaatgaaa aggctttttc ttacagacag atggcctttg attttgccag ggtgaagaaa ggggccgatg gtgtaatgag gacaatggct cccgaaaagc tgctaaagag tatgccaata ctacagggac aaattgatgc actgcttgaa tttgatgtgc atccaaatga actaacaaat ggtgtcataa atgcagcatt tatgcttctt ttcaaagatc ttatcaaact ttttgcttgc tacaatgatg gtgttattaa cttactcgaa aagttttttg aaatgaagaa aggacaatgt aaagatgctc tagaaattta caaacgattt ctaactagaa tgacacgagt gtctgaattt ctcaaggttg cagaggctcc cagcagtctt atggagacgc ttgaacagca tctaaataca ttagaaggaa agaaacctgg aaacaaatct ggtgctccct ctccattaag taagtcttct ccagccacaa ctgttacgtc tcctaattct acaccagcta aaactattga cacatcccca ccggttgatt tatttgcaac tgcatctgcg gctgtcccag tcagcacttc taaaccatct agtgatctcc tggacctcca gccagacttt tcctctggag gggcagcagc agccgcagca ccagcaccac caccacctgc tggaggagcc actgcatggg gaggatttgg gggttctttc atggcgcctt ccccatctcc agtgactcca gctcagaata acctgctaca gcccaatttt gaggcagctt ttgggacaac gccttcaact tccagcagca gctcctttga tccatcagtg tttgatggtc taggtgatct tttgatgcca accatggcac cagctgggca gcctgcacct gtctcaatgg taccacccag tcctgcaatg gcagccagca aagcccttgg aagtgatctt gattcatctc ttgccagctt agtaggcaat cttggaattt ctggtaccac aacaaaaaag ggagatcttc agtggaatgc tggagagaaa aagttgactg gtggagccaa ctggcagcct aaagtagctc cagcaacctg gtcagcaggc gttccaccaa gtgcaccttt gcaaggagct gtacctccaa ccagttcagt tcctcctgtt gccggggccc catcggttgg acaacctgga gcaggatttg gaatgcctcc tgctgggaca ggcatgccca tgatgcctca gcagccggtc atgtttgcac agcccatgat gaggcccccc tttggagctg ccgctgtacc tggcacgcag ctttctccaa gccctacacc tgccagtcag agtcccaaga aacctccagc aaaggaccca ttagcggatc ttaacatcaa ggatttcttg taa. It is sometimes possible for the material contained within the vial of "SNAP91, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.