Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAI1 cdna clone

SNAI1 cDNA Clone

Gene Names
SNAI1; SNA; SNAH; SNAIL; SLUGH2; SNAIL1; dJ710H13.1
Synonyms
SNAI1; SNAI1 cDNA Clone; SNAI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagcgagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctgctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatctgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccaggagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcccagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttccttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcccagctctctgaggccaaggatctccaggctcgaaaggccttcaactgcaaatactgcaacaaggaatacctcagcctgggtgccctcaagatgcacatccgaagccacacgctgccctgcgtctgcggaacctgcgggaaggccttctctaggccctggctgctacaaggccatgtccggacccacactggcgagaagcccttctcctgtccccactgcagccgtgccttcgctgaccgctccaacctgcgggcccacctccagacccactcagatgtcaagaagtaccagtgccaggcgtgtgctcggaccttctcccgaatgtccctgctccacaagcaccaagagtccggctgctcaggatgtccccgctga
Sequence Length
795
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,083 Da
NCBI Official Full Name
Homo sapiens snail homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
snail family transcriptional repressor 1
NCBI Official Symbol
SNAI1
NCBI Official Synonym Symbols
SNA; SNAH; SNAIL; SLUGH2; SNAIL1; dJ710H13.1
NCBI Protein Information
zinc finger protein SNAI1
UniProt Protein Name
Zinc finger protein SNAI1
Protein Family
UniProt Gene Name
SNAI1
UniProt Synonym Gene Names
SNAH; Protein sna
UniProt Entry Name
SNAI1_HUMAN

NCBI Description

The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2. [provided by RefSeq, Jul 2008]

Uniprot Description

Snail1: a protein of the C2H2-type zinc-finger family that regulates transcription. Involved in embryonic mesoderm formation. Plays a role in the epithelial to mesenchymal transition (EMT). EMT is characterized by decreased levels of the epithelial markers E-cadherin and alpha- and beta-catenin, and increased cellular migration and expression of the mesenchymal markers fibronectin, vimentin, N-cadherin and smooth muscle alpha-actin.E Snail binds to 3 E-boxes of the E-cadherin gene promoter and represses its transcription. NF-kappaB binds and regulates the snail promoter and is critical for EMT, and inhibition of NF-kappaB activity lowered snail levels and morphologically reversed the EMT.

Protein type: Transcription factor; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 20q13.2

Cellular Component: cytoplasm; nucleus

Molecular Function: kinase binding; protein binding

Biological Process: epithelial to mesenchymal transition; mesoderm formation; negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of transcription from RNA polymerase II promoter; osteoblast differentiation; positive regulation of cell migration; positive regulation of transcription, DNA-dependent

Research Articles on SNAI1

Similar Products

Product Notes

The SNAI1 snai1 (Catalog #AAA1266054) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcgct ctttcctcgt caggaagccc tccgacccca atcggaagcc taactacagc gagctgcagg actctaatcc agagtttacc ttccagcagc cctacgacca ggcccacctg ctggcagcca tcccacctcc ggagatcctc aaccccaccg cctcgctgcc aatgctcatc tgggactctg tcctggcgcc ccaagcccag ccaattgcct gggcctccct tcggctccag gagagtccca gggtggcaga gctgacctcc ctgtcagatg aggacagtgg gaaaggctcc cagcccccca gcccaccctc accggctcct tcgtccttct cctctacttc agtctcttcc ttggaggccg aggcctatgc tgccttccca ggcttgggcc aagtgcccaa gcagctggcc cagctctctg aggccaagga tctccaggct cgaaaggcct tcaactgcaa atactgcaac aaggaatacc tcagcctggg tgccctcaag atgcacatcc gaagccacac gctgccctgc gtctgcggaa cctgcgggaa ggccttctct aggccctggc tgctacaagg ccatgtccgg acccacactg gcgagaagcc cttctcctgt ccccactgca gccgtgcctt cgctgaccgc tccaacctgc gggcccacct ccagacccac tcagatgtca agaagtacca gtgccaggcg tgtgctcgga ccttctcccg aatgtccctg ctccacaagc accaagagtc cggctgctca ggatgtcccc gctga. It is sometimes possible for the material contained within the vial of "SNAI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.