Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMYD3 cdna clone

SMYD3 cDNA Clone

Gene Names
SMYD3; KMT3E; ZMYND1; ZNFN3A1; bA74P14.1
Synonyms
SMYD3; SMYD3 cDNA Clone; SMYD3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagccgctgaaggtggaaaagttcgcaaccgccaacaggggaaacgggctgcgcgccgtgaccccgctgcgccccggagagctactcttccgctcggatcccttggcgtacacggtgtgcaaggggagtcgtggcgtcgtctgcgaccgctgccttctcgggaaggaaaagctgatgcgatgctctcagtgccgcgtcgccaaatactgtagtgctaagtgtcagaaaaaagcttggccagaccacaagcgggaatgcaaatgccttaaaagctgcaaacccagatatcctccagactccgttcgacttcttggcagagttgtcttcaaacttatggatggagcaccttcagaatcagagaagctttactcattttatgatctggagtcaaatattaacaaactgactgaagataggaaagagggcctcaggcaactcgtaatgacatttcaacatttcatgagagaagaaatacaggatgcctctcagctgccacctgcctttgacctttttgaagcctttgcaaaagtgatctgcaactctttcaccatctgtaatgcggagatgcaggaagttggtgttggcctatatcccagtatctctttgctcaatcacagctgtgaccccaactgttcgattgtgttcaatgggccccacctcttactgcgagcagtccgagacatcgaggtgggagaggagctcaccatctgctacctggatatgctgatgaccagtgaggagcgccggaagcagctgagggaccagtactgctttgaatgtgactgtttccgttgccaaacccaggacaaggatgctgatatgctaactggtgatgagcaagtatggaaggaagttcaagaatccctgaaaaaaattgaagaactgaaggcacactggaagtgggagcaggttctggccatgtgccaggcgatcataagcagcaattctgaacggcttcccgatatcaacatctaccagctgaaggtgctcgactgcgccatggatgcctgcatcaacctcggcctgttggaggaagccttgttctatggtactcggaccatggagccatacaggatttttttcccaggaagccatcccgtcagaggggttcaagtgatgaaagttggcaaactgcagctacatcaaggcatgtttccccaagcaatgaagaatctgagactggcttttgatattatgagagtgacacatggcagagaacacagcctgattgaagatttgattctacttttagaagaatgcgacgccaacatcagagcatcctaa
Sequence Length
1287
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,625 Da
NCBI Official Full Name
Homo sapiens SET and MYND domain containing 3, mRNA
NCBI Official Synonym Full Names
SET and MYND domain containing 3
NCBI Official Symbol
SMYD3
NCBI Official Synonym Symbols
KMT3E; ZMYND1; ZNFN3A1; bA74P14.1
NCBI Protein Information
histone-lysine N-methyltransferase SMYD3
UniProt Protein Name
Histone-lysine N-methyltransferase SMYD3
UniProt Gene Name
SMYD3
UniProt Synonym Gene Names
ZMYND1; ZNFN3A1
UniProt Entry Name
SMYD3_HUMAN

NCBI Description

This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

SMYD3: Histone methyltransferase. Specifically methylates 'Lys- 4' of histone H3, inducing di- and tri-methylation, but not monomethylation. Plays an important role in transcriptional activation as a member of an RNA polymerase complex. Binds DNA containing 5'-CCCTCC-3' or 5'-GAGGGG-3' sequences. Belongs to the histone-lysine methyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Methyltransferase, protein lysine; EC 2.1.1.43

Chromosomal Location of Human Ortholog: 1q44

Cellular Component: nucleoplasm

Molecular Function: histone-lysine N-methyltransferase activity

Research Articles on SMYD3

Similar Products

Product Notes

The SMYD3 smyd3 (Catalog #AAA1271843) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccgc tgaaggtgga aaagttcgca accgccaaca ggggaaacgg gctgcgcgcc gtgaccccgc tgcgccccgg agagctactc ttccgctcgg atcccttggc gtacacggtg tgcaagggga gtcgtggcgt cgtctgcgac cgctgccttc tcgggaagga aaagctgatg cgatgctctc agtgccgcgt cgccaaatac tgtagtgcta agtgtcagaa aaaagcttgg ccagaccaca agcgggaatg caaatgcctt aaaagctgca aacccagata tcctccagac tccgttcgac ttcttggcag agttgtcttc aaacttatgg atggagcacc ttcagaatca gagaagcttt actcatttta tgatctggag tcaaatatta acaaactgac tgaagatagg aaagagggcc tcaggcaact cgtaatgaca tttcaacatt tcatgagaga agaaatacag gatgcctctc agctgccacc tgcctttgac ctttttgaag cctttgcaaa agtgatctgc aactctttca ccatctgtaa tgcggagatg caggaagttg gtgttggcct atatcccagt atctctttgc tcaatcacag ctgtgacccc aactgttcga ttgtgttcaa tgggccccac ctcttactgc gagcagtccg agacatcgag gtgggagagg agctcaccat ctgctacctg gatatgctga tgaccagtga ggagcgccgg aagcagctga gggaccagta ctgctttgaa tgtgactgtt tccgttgcca aacccaggac aaggatgctg atatgctaac tggtgatgag caagtatgga aggaagttca agaatccctg aaaaaaattg aagaactgaa ggcacactgg aagtgggagc aggttctggc catgtgccag gcgatcataa gcagcaattc tgaacggctt cccgatatca acatctacca gctgaaggtg ctcgactgcg ccatggatgc ctgcatcaac ctcggcctgt tggaggaagc cttgttctat ggtactcgga ccatggagcc atacaggatt tttttcccag gaagccatcc cgtcagaggg gttcaagtga tgaaagttgg caaactgcag ctacatcaag gcatgtttcc ccaagcaatg aagaatctga gactggcttt tgatattatg agagtgacac atggcagaga acacagcctg attgaagatt tgattctact tttagaagaa tgcgacgcca acatcagagc atcctaa. It is sometimes possible for the material contained within the vial of "SMYD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.