SMU1 cdna clone
SMU1 cDNA Clone
Gene Names
SMU1; BWD; SMU-1; fSAP57
Synonyms
SMU1; SMU1 cDNA Clone; SMU1 cdna clone
Sequence
atgtcgatcgaaatcgaatcttcggatgtgatccgccttattatgcagtacttgaaggagaacagtttacatcgggcgttagccaccttgcaggaggagactactgtgtctctgaatactgtggacagcattgagagttttgtggctgacattaacagtggccattgggatactgtgttgcaggctatacagtctctgaaattgccagacaaaaccctcattgacctctatgaacaggttgttctggaattgatagagctccgtgaattgggtgctgccaggtcacttttgagacagactgatcccatgatcatgttaaaacaaacacagccagagcgatatattcatctggagaaccttttggccaggtcttactttgatcctcgtgaggcatacccagatggaagtagcaaagaaaagagaagagcagcaattgcccaggccttagctggcgaagtcagtgtggtgcctccatctcgtctcatggcattgctgggacaggcactgaagtggcagcagcatcagggattgcttcctcctggtatgaccatagatttgtttcgaggcaaggcagctgtcaaagatgtggaagaagaaaagtttcctacacaactgagcaggcatattaagtttggtcagaaatcacatgtggagtgtgctcgattttctccagatggtcagtatttggtcactgggtctgttgatggattcattgaagtatggaactttactactggaaaaatcagaaaggatcttaagtaccaggcccaagataactttatgatgatggatgatgctgtcctctgcatgtgtttcagcagagatacagaaatgttagcaactggggcccaagatggaaaaatcaaggtgtggaagattcagagtggacaatgtttaaggagatttgagagggcacacagtaagggtgtcacctgtctaagcttttctaaggatagcagtcagatccttagtgcttcttttgaccagacaattagaattcatggtttaaaatctgggaaaaccctgaaggaatttcgtggccattcctcctttgttaacgaagcaacatttacacaagatggacattacattattagtgcatcctctgatggcactgtaaagatctggaatatgaagaccacagaatgttcaaatacctttaaatccctgggcagcaccgcagggacagatattaccgtcaacagtgtgattctacttcctaaaaaccctgagcactttgtggtgtgcaacagatcaaacacggtggtcatcatgaacatgcaggggcagattgtcagaagcttcagttctggtaaaagagaaggtggggactttgtttgctgtgccctctctccccgtggtgaatggatctactgtgtaggggaggactttgtgctctactgtttcagtacagtcactggcaaactggagagaactttgacagtgcacgagaaggatgtgattggtattgcacatcaccctcatcagaacctgattgctacctacagtgaagatggactcctaaagctctggaaaccataa
Sequence Length
1542
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,343 Da
NCBI Official Full Name
Homo sapiens smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans), mRNA
NCBI Official Synonym Full Names
DNA replication regulator and spliceosomal factor
NCBI Official Symbol
SMU1
NCBI Official Synonym Symbols
BWD; SMU-1; fSAP57
NCBI Protein Information
WD40 repeat-containing protein SMU1
UniProt Protein Name
WD40 repeat-containing protein SMU1
Protein Family
UniProt Gene Name
SMU1
UniProt Entry Name
SMU1_HUMAN
Uniprot Description
SMU1: Belongs to the WD repeat SMU1 family.
Protein type: Spliceosome
Chromosomal Location of Human Ortholog: 9p12
Molecular Function: protein binding
Research Articles on SMU1
Similar Products
Product Notes
The SMU1 smu1 (Catalog #AAA1271872) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgatcg aaatcgaatc ttcggatgtg atccgcctta ttatgcagta cttgaaggag aacagtttac atcgggcgtt agccaccttg caggaggaga ctactgtgtc tctgaatact gtggacagca ttgagagttt tgtggctgac attaacagtg gccattggga tactgtgttg caggctatac agtctctgaa attgccagac aaaaccctca ttgacctcta tgaacaggtt gttctggaat tgatagagct ccgtgaattg ggtgctgcca ggtcactttt gagacagact gatcccatga tcatgttaaa acaaacacag ccagagcgat atattcatct ggagaacctt ttggccaggt cttactttga tcctcgtgag gcatacccag atggaagtag caaagaaaag agaagagcag caattgccca ggccttagct ggcgaagtca gtgtggtgcc tccatctcgt ctcatggcat tgctgggaca ggcactgaag tggcagcagc atcagggatt gcttcctcct ggtatgacca tagatttgtt tcgaggcaag gcagctgtca aagatgtgga agaagaaaag tttcctacac aactgagcag gcatattaag tttggtcaga aatcacatgt ggagtgtgct cgattttctc cagatggtca gtatttggtc actgggtctg ttgatggatt cattgaagta tggaacttta ctactggaaa aatcagaaag gatcttaagt accaggccca agataacttt atgatgatgg atgatgctgt cctctgcatg tgtttcagca gagatacaga aatgttagca actggggccc aagatggaaa aatcaaggtg tggaagattc agagtggaca atgtttaagg agatttgaga gggcacacag taagggtgtc acctgtctaa gcttttctaa ggatagcagt cagatcctta gtgcttcttt tgaccagaca attagaattc atggtttaaa atctgggaaa accctgaagg aatttcgtgg ccattcctcc tttgttaacg aagcaacatt tacacaagat ggacattaca ttattagtgc atcctctgat ggcactgtaa agatctggaa tatgaagacc acagaatgtt caaatacctt taaatccctg ggcagcaccg cagggacaga tattaccgtc aacagtgtga ttctacttcc taaaaaccct gagcactttg tggtgtgcaa cagatcaaac acggtggtca tcatgaacat gcaggggcag attgtcagaa gcttcagttc tggtaaaaga gaaggtgggg actttgtttg ctgtgccctc tctccccgtg gtgaatggat ctactgtgta ggggaggact ttgtgctcta ctgtttcagt acagtcactg gcaaactgga gagaactttg acagtgcacg agaaggatgt gattggtatt gcacatcacc ctcatcagaa cctgattgct acctacagtg aagatggact cctaaagctc tggaaaccat aa. It is sometimes possible for the material contained within the vial of "SMU1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
