Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMPD2 cdna clone

SMPD2 cDNA Clone

Gene Names
SMPD2; ISC1; NSMASE; NSMASE1
Synonyms
SMPD2; SMPD2 cDNA Clone; SMPD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcccaacttctccctgcgactgcggatcttcaacctcaactgctggggcattccgtacttgagcaagcaccgggccgaccgcatgaggcgcctgggagactttctgaaccaggagagcttcgacctggctttgctggaggaggtgtggagtgagcaggacttccagtacctgagacagaagctgtcacctacctacccagctgcacaccacttccggagcggaatcattggcagtggcctctgtgtcttctccaaacatccaatccaggagcttacccagcacatctacactctcaatggctacccctacatgatccatcatggtgactggttcagtgggaaggctgtggggctgctggtgctccatctaagtggcatggtgctcaacgcctatgtgacccatctccatgccgaatacaatcgacagaaggacatctacctagcacatcgtgtggcccaagcttgggaattggcccagttcatccaccacacatccaagaaggcagacgtggttctgttgtgtggagacctcaacatgcacccagaagacctgggctgctgcctgctgaaggagtggacagggcttcatgatgcctatcttgaaactcgggacttcaagggctctgaggaaggcaacacaatggtacccaagaactgctacgtcagccagcaggagctgaagccatttccctttggtgtccgcattgactacgtgctttacaaggcagtttctgggttttacatctcctgtaagagttttgaaaccactacaggctttgaccctcacagtggcacccccctctctgatcatgaagccctgatggctactctgtttgtgaggcacagccccccacagcagaaccccagctctacccacggaccagcagagaggtcgccgttgatgtgtgtgctaaaggaggcctggacggagctgggtctgggcatggctcaggctcgctggtgggccaccttcgctagctatgtgattggcctggggctgcttctcctggcactgctgtgtgtcctggcggctggaggaggggccggggaagctgccatactgctctggacccccagtgtagggctggtgctgtgggcaggtgcattctacctcttccacgtacaggaggtcaatggcttatatagggcccaggctgagctccagcatgtgctaggaagggcaagggaggcccaggatctgggcccagagcctcagccagccctactcctggggcagcaggagggggacagaactaaagaacaataa
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,646 Da
NCBI Official Full Name
Homo sapiens sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase), mRNA
NCBI Official Synonym Full Names
sphingomyelin phosphodiesterase 2
NCBI Official Symbol
SMPD2
NCBI Official Synonym Symbols
ISC1; NSMASE; NSMASE1
NCBI Protein Information
sphingomyelin phosphodiesterase 2
UniProt Protein Name
Sphingomyelin phosphodiesterase 2
UniProt Gene Name
SMPD2
UniProt Synonym Gene Names
Lyso-PAF-PLC; N-SMase; nSMase
UniProt Entry Name
NSMA_HUMAN

NCBI Description

This gene encodes a protein which was initially identified as a sphingomyelinase based on sequence similarity between bacterial sphingomyelinases and a yeast protein. Subsequent studies showed that its biological function is less likely to be as a sphingomyelinase and instead as a lysophospholipase. [provided by RefSeq, Oct 2009]

Uniprot Description

SMPD2: Converts sphingomyelin to ceramide. Hydrolyze 1-acyl-2- lyso-sn-glycero-3-phosphocholine (lyso-PC) and 1-O-alkyl-2-lyso- sn-glycero-3-phosphocholine (lyso-platelet-activating factor). The physiological substrate seems to be Lyso-PAF. Belongs to the neutral sphingomyelinase family.

Protein type: EC 3.1.4.12; Phosphodiesterase; Membrane protein, multi-pass; Membrane protein, integral; Lipid Metabolism - sphingolipid

Chromosomal Location of Human Ortholog: 6q21

Cellular Component: integral to plasma membrane; plasma membrane

Biological Process: glycosphingolipid metabolic process; sphingomyelin metabolic process

Research Articles on SMPD2

Similar Products

Product Notes

The SMPD2 smpd2 (Catalog #AAA1272826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccca acttctccct gcgactgcgg atcttcaacc tcaactgctg gggcattccg tacttgagca agcaccgggc cgaccgcatg aggcgcctgg gagactttct gaaccaggag agcttcgacc tggctttgct ggaggaggtg tggagtgagc aggacttcca gtacctgaga cagaagctgt cacctaccta cccagctgca caccacttcc ggagcggaat cattggcagt ggcctctgtg tcttctccaa acatccaatc caggagctta cccagcacat ctacactctc aatggctacc cctacatgat ccatcatggt gactggttca gtgggaaggc tgtggggctg ctggtgctcc atctaagtgg catggtgctc aacgcctatg tgacccatct ccatgccgaa tacaatcgac agaaggacat ctacctagca catcgtgtgg cccaagcttg ggaattggcc cagttcatcc accacacatc caagaaggca gacgtggttc tgttgtgtgg agacctcaac atgcacccag aagacctggg ctgctgcctg ctgaaggagt ggacagggct tcatgatgcc tatcttgaaa ctcgggactt caagggctct gaggaaggca acacaatggt acccaagaac tgctacgtca gccagcagga gctgaagcca tttccctttg gtgtccgcat tgactacgtg ctttacaagg cagtttctgg gttttacatc tcctgtaaga gttttgaaac cactacaggc tttgaccctc acagtggcac ccccctctct gatcatgaag ccctgatggc tactctgttt gtgaggcaca gccccccaca gcagaacccc agctctaccc acggaccagc agagaggtcg ccgttgatgt gtgtgctaaa ggaggcctgg acggagctgg gtctgggcat ggctcaggct cgctggtggg ccaccttcgc tagctatgtg attggcctgg ggctgcttct cctggcactg ctgtgtgtcc tggcggctgg aggaggggcc ggggaagctg ccatactgct ctggaccccc agtgtagggc tggtgctgtg ggcaggtgca ttctacctct tccacgtaca ggaggtcaat ggcttatata gggcccaggc tgagctccag catgtgctag gaagggcaag ggaggcccag gatctgggcc cagagcctca gccagcccta ctcctggggc agcaggaggg ggacagaact aaagaacaat aa. It is sometimes possible for the material contained within the vial of "SMPD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.