Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMNDC1 cdna clone

SMNDC1 cDNA Clone

Gene Names
SMNDC1; SMNR; SPF30; TDRD16C
Synonyms
SMNDC1; SMNDC1 cDNA Clone; SMNDC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagaggatttagcaaagcagctggcaagctacaaagctcagctccagcaagttgaagctgcattatctggaaatggagaaaatgaagatttgctaaaattgaagaaagatttacaagaagttatagaactaaccaaagaccttctgtcaactcaaccttctgagacgcttgcaagttcagacagttttgcttctactcaacctactcattcatggaaagtaggagacaagtgtatggcagtctggagtgaagatggacagtgttatgaagcggagattgaggagatagatgaagaaaatggcaccgctgcaatcacctttgctggttatggcaatgctgaagtgactccactgttgaacctcaagcctgtagaagaaggaaggaaggcaaaggaggacagtggcaacaaacccatgtcaaaaaaagaaatgattgcccagcagcgtgaatataaaaagaagaaagctttgaaaaaagctcagagaataaaagaacttgagcaggaaagagaggaccagaaagtgaaatggcaacaattcaacaacagagcctattctaaaaacaaaaaaggccaggtaaagaggagtatttttgcttcacctgagagtgtgactggtaaagttggagtaggaacctgtggaattgctgataaacctatgacacaatatcaagatacctctaaatacaatgtcaggcatttgatgcctcaataa
Sequence Length
717
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,711 Da
NCBI Official Full Name
Homo sapiens survival motor neuron domain containing 1, mRNA
NCBI Official Synonym Full Names
survival motor neuron domain containing 1
NCBI Official Symbol
SMNDC1
NCBI Official Synonym Symbols
SMNR; SPF30; TDRD16C
NCBI Protein Information
survival of motor neuron-related-splicing factor 30
UniProt Protein Name
Survival of motor neuron-related-splicing factor 30
UniProt Gene Name
SMNDC1
UniProt Synonym Gene Names
SMNR; SPF30
UniProt Entry Name
SPF30_HUMAN

NCBI Description

This gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. The protein encoded by this gene is a nuclear protein that has been identified as a constituent of the spliceosome complex. This gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SPF30: Necessary for spliceosome assembly. Overexpression causes apoptosis. Belongs to the SMN family.

Protein type: RNA-binding; RNA processing; Spliceosome; RNA splicing

Chromosomal Location of Human Ortholog: 10q23

Cellular Component: nucleus

Molecular Function: protein binding

Biological Process: RNA splicing, via transesterification reactions

Research Articles on SMNDC1

Similar Products

Product Notes

The SMNDC1 smndc1 (Catalog #AAA1271267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagagg atttagcaaa gcagctggca agctacaaag ctcagctcca gcaagttgaa gctgcattat ctggaaatgg agaaaatgaa gatttgctaa aattgaagaa agatttacaa gaagttatag aactaaccaa agaccttctg tcaactcaac cttctgagac gcttgcaagt tcagacagtt ttgcttctac tcaacctact cattcatgga aagtaggaga caagtgtatg gcagtctgga gtgaagatgg acagtgttat gaagcggaga ttgaggagat agatgaagaa aatggcaccg ctgcaatcac ctttgctggt tatggcaatg ctgaagtgac tccactgttg aacctcaagc ctgtagaaga aggaaggaag gcaaaggagg acagtggcaa caaacccatg tcaaaaaaag aaatgattgc ccagcagcgt gaatataaaa agaagaaagc tttgaaaaaa gctcagagaa taaaagaact tgagcaggaa agagaggacc agaaagtgaa atggcaacaa ttcaacaaca gagcctattc taaaaacaaa aaaggccagg taaagaggag tatttttgct tcacctgaga gtgtgactgg taaagttgga gtaggaacct gtggaattgc tgataaacct atgacacaat atcaagatac ctctaaatac aatgtcaggc atttgatgcc tcaataa. It is sometimes possible for the material contained within the vial of "SMNDC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.