Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCE1 cdna clone

SMARCE1 cDNA Clone

Gene Names
SMARCE1; CSS5; BAF57
Synonyms
SMARCE1; SMARCE1 cDNA Clone; SMARCE1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaaaaagaccatcttatgccccacctcccaccccagctcctgcaacacaaatgcccagcacaccagggtttgtgggatacaatccatacagtcatctcgcctacaacaactacaggctgggagggaacccgggcaccaacagccgggtcacggcatcctctggtatcacgattccaaaacccccaaagccaccagataagccgctgatgccctacatgaggtacagcagaaaggtctgggaccaagtaaaggcttccaaccctgacctaaagttgtgggagattggcaagattattggtggcatgtggcgagatctcactgatgaagaaaaacaagaatatttaaacgaatacgaagcagaaaagatagagtacaatgaatctatgaaggcctatcataattcccccgcgtaccttgcttacataaatgcaaaaagtcgtgcagaagctgctttagaggaagaaagtcgacagagacaatctcgcatggagaaaggagaaccgtacatgagcattcagcctgctgaagatccagatgattatgatgatggcttttcaatgaagcatacagccaccgcccgtttccagagaaaccaccgcctcatcagtgaaattcttagtgagagtgtggtgccagacgttcggtcagttgtcacaacagctagaatgcaggtcctcaaacggcaggtccagtccttaatggttcatcagcgaaaactagaagctgaacttcttcaaatagaggaacgacaccaggagaagaagaggaaattcctggaaagcacagattcatttaacaatgaacttaaaaggttgtgcggtctgaaagtagaagtggatatggagaaaattgcagctgagattgcacaggcagaggaacaggcccgcaaaaggcaggaggaaagggagaaggaggccgcagagcaagctgagcgcagtcagagcagcatcgttcctgaggaagaacaagcagctaacaaaggcgaggagaagaaagacgacgagaacattccgatggagacagaggagacacaccttgaagaaacaacagagagccaacagaatggtgaagaaggcacgtctactcctgaggacaaggagagtgggcaggagggggtcgacagtatggcagaggaaggaaccagtgatagtaacactggctcggagagcaacagtgcaacagtggaggagccaccaacagatcccataccagaagatgagaaaaaagaataa
Sequence Length
1236
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,390 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
NCBI Official Symbol
SMARCE1
NCBI Official Synonym Symbols
CSS5; BAF57
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1
UniProt Gene Name
SMARCE1
UniProt Synonym Gene Names
BAF57; BAF57
UniProt Entry Name
SMCE1_HUMAN

NCBI Description

The protein encoded by this gene is part of the large ATP-dependent chromatin remodeling complex SWI/SNF, which is required for transcriptional activation of genes normally repressed by chromatin. The encoded protein, either alone or when in the SWI/SNF complex, can bind to 4-way junction DNA, which is thought to mimic the topology of DNA as it enters or exits the nucleosome. The protein contains a DNA-binding HMG domain, but disruption of this domain does not abolish the DNA-binding or nucleosome-displacement activities of the SWI/SNF complex. Unlike most of the SWI/SNF complex proteins, this protein has no yeast counterpart. [provided by RefSeq, Jul 2008]

Uniprot Description

SMARCE1: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Required for the coactivation of estrogen responsive promoters by Swi/Snf complexes and the SRC/p160 family of histone acetyltransferases (HATs). Also specifically interacts with the CoREST corepressor resulting in repression of neuronal specific gene promoters in non-neuronal cells. Also involved in vitamin D-coupled transcription regulation via its association with the WINAC complex, a chromatin-remodeling complex recruited by vitamin D receptor (VDR), which is required for the ligand-bound VDR-mediated transrepression of the CYP27B1 gene. Defects in SMARCE1 may be a cause of Coffin-Siris syndrome, a highly variable disease characterized by mental retardation associated with a broad spectrum of different clinical features. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 17q21.2

Cellular Component: nuclear chromatin; nuclear chromosome; nucleoplasm; nucleus; protein complex; SWI/SNF complex; transcriptional repressor complex

Molecular Function: chromatin binding; ligand-dependent nuclear receptor binding; N-acetyltransferase activity; nucleosomal DNA binding; protein binding; protein N-terminus binding

Biological Process: ATP-dependent chromatin remodeling; chromatin remodeling; negative regulation of transcription, DNA-dependent; nucleosome disassembly

Disease: Coffin-siris Syndrome 5; Meningioma, Familial, Susceptibility To

Research Articles on SMARCE1

Similar Products

Product Notes

The SMARCE1 smarce1 (Catalog #AAA1267447) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaaaaa gaccatctta tgccccacct cccaccccag ctcctgcaac acaaatgccc agcacaccag ggtttgtggg atacaatcca tacagtcatc tcgcctacaa caactacagg ctgggaggga acccgggcac caacagccgg gtcacggcat cctctggtat cacgattcca aaacccccaa agccaccaga taagccgctg atgccctaca tgaggtacag cagaaaggtc tgggaccaag taaaggcttc caaccctgac ctaaagttgt gggagattgg caagattatt ggtggcatgt ggcgagatct cactgatgaa gaaaaacaag aatatttaaa cgaatacgaa gcagaaaaga tagagtacaa tgaatctatg aaggcctatc ataattcccc cgcgtacctt gcttacataa atgcaaaaag tcgtgcagaa gctgctttag aggaagaaag tcgacagaga caatctcgca tggagaaagg agaaccgtac atgagcattc agcctgctga agatccagat gattatgatg atggcttttc aatgaagcat acagccaccg cccgtttcca gagaaaccac cgcctcatca gtgaaattct tagtgagagt gtggtgccag acgttcggtc agttgtcaca acagctagaa tgcaggtcct caaacggcag gtccagtcct taatggttca tcagcgaaaa ctagaagctg aacttcttca aatagaggaa cgacaccagg agaagaagag gaaattcctg gaaagcacag attcatttaa caatgaactt aaaaggttgt gcggtctgaa agtagaagtg gatatggaga aaattgcagc tgagattgca caggcagagg aacaggcccg caaaaggcag gaggaaaggg agaaggaggc cgcagagcaa gctgagcgca gtcagagcag catcgttcct gaggaagaac aagcagctaa caaaggcgag gagaagaaag acgacgagaa cattccgatg gagacagagg agacacacct tgaagaaaca acagagagcc aacagaatgg tgaagaaggc acgtctactc ctgaggacaa ggagagtggg caggaggggg tcgacagtat ggcagaggaa ggaaccagtg atagtaacac tggctcggag agcaacagtg caacagtgga ggagccacca acagatccca taccagaaga tgagaaaaaa gaataa. It is sometimes possible for the material contained within the vial of "SMARCE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.