Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCD1 cdna clone

SMARCD1 cDNA Clone

Gene Names
SMARCD1; Rsc6p; BAF60A; CRACD1
Synonyms
SMARCD1; SMARCD1 cDNA Clone; SMARCD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcccgggcgggtttccagtctgtggctccaagcggcggcgccggagcctcaggaggggcgggcgcggctgctgccttgggcccgggcggaactccggggcctcctgtgcgaatgggcccggctccgggtcaagggctgtaccgctccccgatgcccggagcggcctatccgagaccaggtatgttgccaggcagccgaatgacacctcagggaccttccatgggaccccctggctatggggggaacccttcagtccgacctggcctggcccagtcagggatggatcagtcccgcaagagacctgcccctcagcagatccagcaggtccagcagcaggcggtccaaaatcgaaaccacaatgcaaagaaaaagaagatggctgacaaaattctacctcaaaggattcgtgaactggtaccagaatcccaggcctatatggatctcttggcttttgaaaggaaactggaccagactatcatgaggaaacggctagatatccaagaggccttgaaacgtcccatcaagcaaaaacggaagctgcgaattttcatttctaacactttcaatccggctaagtcagatgccgaggatggggaagggacggtggcttcctgggagcttcgggtagaaggacggctcctggaggattcagccttgtccaaatatgatgccactaaacaaaagaggaagttctcttccttttttaagtccttggtgattgaactggacaaagacctgtatgggccagacaaccatctggtagaatggcacaggaccgccactacccaggagaccgatggctttcaggtgaagcggccgggagacgtgaatgtacggtgtactgtcctactgatgctggattaccagcctccccagtttaaattagacccccgcctagctcgactcctgggcatccatacccagactcgtccagtgatcatccaagcactgtggcaatatattaagacacataagctccaggaccctcacgagcgggagtttgtcatctgtgacaagtacctgcagcagatctttgagtctcaacgtatgaagttttcagagatccctcagcggctccatgccttgcttatgccaccagaacctatcatcattaatcatgtcatcagtgttgacccgaatgatcagaaaaagacagcttgttatgacattgatgttgaagtggatgacaccttgaagacccagatgaattcttttctgctgtccactgccagccaacaggagattgctactctagacaacaagatccatgagacaatagaaaccatcaaccagctgaagactcagcgggagttcatgctgagctttgccagagaccctcagggtttcatcaatgactggcttcagtcccagtgcagggacctcaagacaatgactgatgtggtgggtaacccagaggaggagcgccgagctgagttctacttccagccctgggctcaggaggctgtgtgccgatacttctactccaaggtgcagcagagacgacaagaattagagcaagccctgggaatccggaatacatag
Sequence Length
1548
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,299 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
NCBI Official Symbol
SMARCD1
NCBI Official Synonym Symbols
Rsc6p; BAF60A; CRACD1
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1
UniProt Gene Name
SMARCD1
UniProt Synonym Gene Names
BAF60A
UniProt Entry Name
SMRD1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SMARCD1: Involved in chromatin remodeling. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Has a strong influence on the Vitamin D-mediated transcriptional activity from an enhancer Vitamin D receptor element (VDRE). May be a link between mammalian SWI-SNF-like chromatin remodeling complexes and the vitamin D receptor (VDR) heterodimer. Mediates critical interactions between nuclear receptors and the BRG1/SMARCA4 chromatin-remodeling complex for transactivation. Also involved in vitamin D-coupled transcription regulation via its association with the WINAC complex, a chromatin-remodeling complex recruited by vitamin D receptor (VDR), which is required for the ligand- bound VDR-mediated transrepression of the CYP27B1 gene. Belongs to the SMARCD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 12q13-q14

Cellular Component: SWI/SNF complex

Molecular Function: protein binding; protein complex scaffold

Biological Process: chromatin remodeling; chromatin-mediated maintenance of transcription; nucleosome disassembly

Research Articles on SMARCD1

Similar Products

Product Notes

The SMARCD1 smarcd1 (Catalog #AAA1266766) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccc gggcgggttt ccagtctgtg gctccaagcg gcggcgccgg agcctcagga ggggcgggcg cggctgctgc cttgggcccg ggcggaactc cggggcctcc tgtgcgaatg ggcccggctc cgggtcaagg gctgtaccgc tccccgatgc ccggagcggc ctatccgaga ccaggtatgt tgccaggcag ccgaatgaca cctcagggac cttccatggg accccctggc tatgggggga acccttcagt ccgacctggc ctggcccagt cagggatgga tcagtcccgc aagagacctg cccctcagca gatccagcag gtccagcagc aggcggtcca aaatcgaaac cacaatgcaa agaaaaagaa gatggctgac aaaattctac ctcaaaggat tcgtgaactg gtaccagaat cccaggccta tatggatctc ttggcttttg aaaggaaact ggaccagact atcatgagga aacggctaga tatccaagag gccttgaaac gtcccatcaa gcaaaaacgg aagctgcgaa ttttcatttc taacactttc aatccggcta agtcagatgc cgaggatggg gaagggacgg tggcttcctg ggagcttcgg gtagaaggac ggctcctgga ggattcagcc ttgtccaaat atgatgccac taaacaaaag aggaagttct cttccttttt taagtccttg gtgattgaac tggacaaaga cctgtatggg ccagacaacc atctggtaga atggcacagg accgccacta cccaggagac cgatggcttt caggtgaagc ggccgggaga cgtgaatgta cggtgtactg tcctactgat gctggattac cagcctcccc agtttaaatt agacccccgc ctagctcgac tcctgggcat ccatacccag actcgtccag tgatcatcca agcactgtgg caatatatta agacacataa gctccaggac cctcacgagc gggagtttgt catctgtgac aagtacctgc agcagatctt tgagtctcaa cgtatgaagt tttcagagat ccctcagcgg ctccatgcct tgcttatgcc accagaacct atcatcatta atcatgtcat cagtgttgac ccgaatgatc agaaaaagac agcttgttat gacattgatg ttgaagtgga tgacaccttg aagacccaga tgaattcttt tctgctgtcc actgccagcc aacaggagat tgctactcta gacaacaaga tccatgagac aatagaaacc atcaaccagc tgaagactca gcgggagttc atgctgagct ttgccagaga ccctcagggt ttcatcaatg actggcttca gtcccagtgc agggacctca agacaatgac tgatgtggtg ggtaacccag aggaggagcg ccgagctgag ttctacttcc agccctgggc tcaggaggct gtgtgccgat acttctactc caaggtgcag cagagacgac aagaattaga gcaagccctg ggaatccgga atacatag. It is sometimes possible for the material contained within the vial of "SMARCD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.