Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCAL1 cdna clone

SMARCAL1 cDNA Clone

Gene Names
SMARCAL1; HARP; HHARP
Synonyms
SMARCAL1; SMARCAL1 cDNA Clone; SMARCAL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccttgcctcttacagaggagcagaggaaaaagattgaagagaatcgacaaaaggctctggcccgcagagctgagaagttattggcagaacagcatcagaggactagctcgggcacctccattgctggcaacccattccaggccaagcaaggcccatcccaaaatttcccaagggagtcttgtaagccagtgagccatggtgtcattttcaagcaacagaatctcagtagctcatctaatgctgaccaaagacctcatgattcccacagttttcaggcaaagggaatatggaaaaagccagaagaaatgcccacagcctgcccaggccacagtccacgtagtcaaatggctctcactggaatctctcctcccttggcacaaagtcctccagaggtccctaaacaacagctcttgagttatgagttaggtcaaggtcatgctcaggcttcacctgagatcaggttcacaccctttgctaacccaactcataagcctctggccaaaccaaagagttcccaagagacaccagctcattcctctggacagcctcccagggatgctaagttagaggccaagacagcaaaagcctccccttcggggcagaacatttcttacatccattctagctcagagagtgtaacgcccaggacagaaggaagactccagcagaagtcagggtcctcagtccaaaaaggagtgaactctcagaagggaaagtgcgtaaggaacggcgatcgtttccaggtgttgattgggtacaatgcggaactcattgcagtgtttaagaccctgcccagcaagaattatgatcctgacaccaagacgtggaacttcagcatgaatgactatagtgccctgatgaaagcagcccagagcctccccacggtcaacctgcagcctctggaatgggcctatggcagcagcgagtcaccctccaccagcagtgagggacaggccggccttccatcagctccatccctttcatttgtcaaagggcgatgcatgctcatctccagggcctacttcgaggcagacatcagttattcacaggaccttattgcgctttttaaacagatggattccagaagatatgatgtcaagaccaggaagtggagctttctcttggaagagcacagtaaactaattgcaaaggtgcgctgcctcccacaagttcagctggaccctctgcccacgactctcaccctggcgtttgcttctcagctcaagaagacatctctcagtctcacgccagatgtcccagaggcagacctttctgaagtggaccccaagctcgtgtctaatctgatgccctttcagagagctggagtcaattttgccatagccaaaggaggccgcctgctgctcgctgacgacatgggcctggggaagaccatccaagccatctgcatcgcagccttttaccggaaggagtggccgctcctggtggtggtgccatcctccgtgcgcttcacctgggagcaggccttccttcggtggctgccatctctgagcccagattgcatcaacgtcgtggtgactgggaaggaccgcctgacagctggcctgatcaacattgtcagctttgaccttcttagcaagttggaaaaacagctaaaaaccccttttaaagttgtcatcattgatgaatctcacttcctcaaaaacagtaggactgcccgctgtcgagcagctatgccggtcctaaaggttgccaagagggtgatcctgttgtcgggcacaccagccatgtcccggcccgcagagctctacacgcagatcatcgcagtcaagccaactttcttcccccagtttcatgcctttggacttcgctactgtgatgccaaacggatgccttgggggtgggactactcaggttcctccaacctgggagagctgaagctcctgctggaggaagcagtcatgctgcggcgcctcaagtccgacgtcctttcccagctgcctgccaagcagcgcaagatagtggtgattgccccaggacggatcaatgccaggaccagagctgccctggatgctgcagccaaggaaatgaccaccaaggacaaaactaaacagcagcagaaagatgccctcattctcttcttcaacagaacagctgaagctaaaatcccatctgtcattgaatatatcttggacctactggaaagtggaagagagaagtttttagtatttgcacaccataaggtggtcctggacgcaattacgcaagagcttgagagaaagcacgtgcagcacatccgcatcgatggctccacctcatcagctgagcgggaggacctgtgccagcagttccaactgtcggagaggcatgctgtggccgtgctgtccatcaccgctgccaatatgggcctcaccttctcctcggctgacctggtggtgtttgctgagctgttttggaacccaggggtgctgatccaggctgaggaccgcgtgcaccgcattggacagaccagctccgtgggcattcactacctcgtggcaaagggcacagctgatgactacctttggcccctgattcaagagaagattaaagttctggcagaagccgggctttctgagaccaatttttcagaaatgacagaatccactgattacctctacaaggacccaaagcagcagaagatctacgacctattccagaagtcctttgagaaagaaggaagtgatatggagctcctggaagcagcagagtcctttgacccaggaagtgcttcaggaacatctggaagtagttcccagaacatgggagacaccctggatgaaagctcattgacagccagtccacagaagaaaaggagatttgaattttttgataactgggacagctttacgtctcccctgtaa
Sequence Length
2865
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
105,938 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a like 1
NCBI Official Symbol
SMARCAL1
NCBI Official Synonym Symbols
HARP; HHARP
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1
UniProt Gene Name
SMARCAL1
UniProt Synonym Gene Names
HARP; hHARP
UniProt Entry Name
SMAL1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]

Uniprot Description

SMARCAL1: ATP-dependent annealing helicase that catalyzes the rewinding of the stably unwound DNA. Rewinds single-stranded DNA bubbles that are stably bound by replication protein A (RPA). Acts throughout the genome to reanneal stably unwound DNA, performing the opposite reaction of many enzymes, such as helicases and polymerases, that unwind DNA. Defects in SMARCAL1 are a cause of Schimke immuno-osseous dysplasia (SIOD). SIOD causes spondyloepiphyseal dysplasia, renal dysfunction and T-cell immunodeficiency. Approximately half of all patients also exhibit hyperthyroidism, while around half also exhibit episodal cerebral ischema. Belongs to the SNF2/RAD54 helicase family. SMARCAL1 subfamily.

Protein type: EC 3.6.1.-; EC 3.6.4.-; Helicase

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: DNA replication factor A complex; nucleoplasm; nucleus

Molecular Function: DNA-dependent ATPase activity; protein binding

Biological Process: DNA metabolic process; regulation of transcription from RNA polymerase II promoter; replication fork processing; response to DNA damage stimulus

Disease: Immunoosseous Dysplasia, Schimke Type

Research Articles on SMARCAL1

Similar Products

Product Notes

The SMARCAL1 smarcal1 (Catalog #AAA1276685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccttgc ctcttacaga ggagcagagg aaaaagattg aagagaatcg acaaaaggct ctggcccgca gagctgagaa gttattggca gaacagcatc agaggactag ctcgggcacc tccattgctg gcaacccatt ccaggccaag caaggcccat cccaaaattt cccaagggag tcttgtaagc cagtgagcca tggtgtcatt ttcaagcaac agaatctcag tagctcatct aatgctgacc aaagacctca tgattcccac agttttcagg caaagggaat atggaaaaag ccagaagaaa tgcccacagc ctgcccaggc cacagtccac gtagtcaaat ggctctcact ggaatctctc ctcccttggc acaaagtcct ccagaggtcc ctaaacaaca gctcttgagt tatgagttag gtcaaggtca tgctcaggct tcacctgaga tcaggttcac accctttgct aacccaactc ataagcctct ggccaaacca aagagttccc aagagacacc agctcattcc tctggacagc ctcccaggga tgctaagtta gaggccaaga cagcaaaagc ctccccttcg gggcagaaca tttcttacat ccattctagc tcagagagtg taacgcccag gacagaagga agactccagc agaagtcagg gtcctcagtc caaaaaggag tgaactctca gaagggaaag tgcgtaagga acggcgatcg tttccaggtg ttgattgggt acaatgcgga actcattgca gtgtttaaga ccctgcccag caagaattat gatcctgaca ccaagacgtg gaacttcagc atgaatgact atagtgccct gatgaaagca gcccagagcc tccccacggt caacctgcag cctctggaat gggcctatgg cagcagcgag tcaccctcca ccagcagtga gggacaggcc ggccttccat cagctccatc cctttcattt gtcaaagggc gatgcatgct catctccagg gcctacttcg aggcagacat cagttattca caggacctta ttgcgctttt taaacagatg gattccagaa gatatgatgt caagaccagg aagtggagct ttctcttgga agagcacagt aaactaattg caaaggtgcg ctgcctccca caagttcagc tggaccctct gcccacgact ctcaccctgg cgtttgcttc tcagctcaag aagacatctc tcagtctcac gccagatgtc ccagaggcag acctttctga agtggacccc aagctcgtgt ctaatctgat gccctttcag agagctggag tcaattttgc catagccaaa ggaggccgcc tgctgctcgc tgacgacatg ggcctgggga agaccatcca agccatctgc atcgcagcct tttaccggaa ggagtggccg ctcctggtgg tggtgccatc ctccgtgcgc ttcacctggg agcaggcctt ccttcggtgg ctgccatctc tgagcccaga ttgcatcaac gtcgtggtga ctgggaagga ccgcctgaca gctggcctga tcaacattgt cagctttgac cttcttagca agttggaaaa acagctaaaa acccctttta aagttgtcat cattgatgaa tctcacttcc tcaaaaacag taggactgcc cgctgtcgag cagctatgcc ggtcctaaag gttgccaaga gggtgatcct gttgtcgggc acaccagcca tgtcccggcc cgcagagctc tacacgcaga tcatcgcagt caagccaact ttcttccccc agtttcatgc ctttggactt cgctactgtg atgccaaacg gatgccttgg gggtgggact actcaggttc ctccaacctg ggagagctga agctcctgct ggaggaagca gtcatgctgc ggcgcctcaa gtccgacgtc ctttcccagc tgcctgccaa gcagcgcaag atagtggtga ttgccccagg acggatcaat gccaggacca gagctgccct ggatgctgca gccaaggaaa tgaccaccaa ggacaaaact aaacagcagc agaaagatgc cctcattctc ttcttcaaca gaacagctga agctaaaatc ccatctgtca ttgaatatat cttggaccta ctggaaagtg gaagagagaa gtttttagta tttgcacacc ataaggtggt cctggacgca attacgcaag agcttgagag aaagcacgtg cagcacatcc gcatcgatgg ctccacctca tcagctgagc gggaggacct gtgccagcag ttccaactgt cggagaggca tgctgtggcc gtgctgtcca tcaccgctgc caatatgggc ctcaccttct cctcggctga cctggtggtg tttgctgagc tgttttggaa cccaggggtg ctgatccagg ctgaggaccg cgtgcaccgc attggacaga ccagctccgt gggcattcac tacctcgtgg caaagggcac agctgatgac tacctttggc ccctgattca agagaagatt aaagttctgg cagaagccgg gctttctgag accaattttt cagaaatgac agaatccact gattacctct acaaggaccc aaagcagcag aagatctacg acctattcca gaagtccttt gagaaagaag gaagtgatat ggagctcctg gaagcagcag agtcctttga cccaggaagt gcttcaggaa catctggaag tagttcccag aacatgggag acaccctgga tgaaagctca ttgacagcca gtccacagaa gaaaaggaga tttgaatttt ttgataactg ggacagcttt acgtctcccc tgtaa. It is sometimes possible for the material contained within the vial of "SMARCAL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.