Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMARCA5 cdna clone

SMARCA5 cDNA Clone

Gene Names
SMARCA5; ISWI; SNF2H; hISWI; hSNF2H; WCRF135
Synonyms
SMARCA5; SMARCA5 cDNA Clone; SMARCA5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtccgcggccgagcctccgccacccccgcctcccgagagcgcgccttccaagcccgcagcctcgatcgccagcggcgggagcaacagcagcaacaaaggcggccccgaaggcgtcgcggcgcaggcggttgcgtctgcggccagcgctggtcccgcagacgccgagatggaggaaatatttgatgatgcgtcacctggaaagcaaaaggaaatccaagaaccagatcctacctatgaagaaaaaatgcaaactgaccgggcaaatagattcgagtatttattaaagcagacagaactttttgcacatttcattcaacctgctgctcagaagactccaacttcacctttgaagatgaaaccagggcgcccacgaataaaaaaagatgagaagcagaacttactatccgttggcgattaccgacaccgtagaacagagcaagaggaggatgaagagctattaacagaaagctccaaagcaaccaatgtttgcactcgatttgaagactctccatcgtatgtaaaatggggtaaactgagagattatcaggtccgaggattaaactggctcatttctttgtatgagaatggcatcaatggtatccttgcagatgaaatgggcctaggaaagactcttcaaacaatttctcttcttgggtacatgaaacattatagaaacattcctgggcctcatatggttttggttcctaagtctacattacacaactggatgagtgaattcaagagatgggtaccaacacttagatctgtttgtttgataggagataaagaacaaagagctgcttttgtcagagacgttttattaccgggagaatgggatgtatgtgtaacatcttatgaaatgcttattaaagagaagtctgtgttcaaaaaatttaattggagatacttagtaatagatgaagctcacaggatcaaaaatgaaaaatctaagttgtcagaaatagtgagggaattcaagactacaaatagactattattaactggaacacctcttcagaacaacttgcatgagctgtggtcacttcttaactttctgttgccagatgtgtttaattcagcagatgactttgattcctggtttgatacaaacaactgccttggggatcaaaaactagttgagaggcttcatatggttttgcgtccattcctccttcgtcgaattaaggctgatgttgaaaagagtttgcctccaaagaaggaagtaaaaatctatgtgggcctcagcaaaatgcaaagggaatggtatactcggatattaatgaaggatatagatatactcaactcagcaggcaagatggacaaaatgaggttattgaacatcctaatgcagttgagaaaatgttgtaatcatccatatctctttgatggagcagaacctggtccaccttatacaacagatatgcatctagtaaccaacagtggcaaaatggtggttttagacaagctgctccctaagttaaaagaacaaggttcacgagtactaatcttcagtcaaatgacaagggtattggacattttggaagattattgcatgtggagaaattatgagtactgcaggttggatggtcagacaccccatgatgagagacaagactccatcaatgcatacaatgaaccaaacagcacaaagtttgttttcatgttaagcacgcgtgctggtggtcttggcatcaatcttgcgactgctgatgtagtaattttgtatgattctgattggaatccccaagtagatcttcaggctatggaccgagcacatagaattgggcagactaagacagtcagagtgttccgctttataactgataacactgtagaagaaagaatagtagaacgtgctgagatgaaactcagactggattcaatagtcattcaacaagggaggcttgtggatcagaatctgaacaaaattgggaaagatgaaatgcttcaaatgattagacatggagcaacacatgtgtttgcttcaaaggaaagtgagatcactgatgaagatatcgatggtattttggaaagaggtgcaaagaagactgcagagatgaatgaaaagctctccaagatgggcgaaagttcacttagaaactttacaatggatacagagtcaagtgtttataacttcgaaggagaagactatagagaaaaacaaaagattgcattcacagagtggattgaaccacctaaacgagaaagaaaagccaactatgccgttgatgcatatttcagggaagctcttcgtgttagtgaacctaaagcacccaaggctcctcgacctccaaaacaacccaatgttcaggatttccagttctttcctccacgtttatttgaattactggaaaaagaaattctgttttacagaaaaactattgggtacaaggtacctcgaaatcctgagctgcctaacgcagcacaggcacaaaaagaagaacagcttaaaattgatgaagctgaatcccttaatgatgaagagttagaggaaaaagagaagcttctaacacagggatttaccaattggaataagagagattttaaccagtttatcaaagctaatgagaagtggggtcgtgatgatattgaaaatatagcaagagaagtagaaggcaaaactccagaagaagtcattgaatattcagctgtgttttgggaaaggtgcaacgagctccaggacatagagaagattatggctcagattgaaaggggagaggcgagaattcaaagaagaataagcatcaagaaagcacttgacacaaagattggacggtacaaagcaccttttcatcagctgagaatatcatatggtactaacaaaggaaaaaactatactgaagaagaagatcgttttctgatttgtatgcttcacaaacttggatttgacaaagaaaatgtttatgatgaattgcgacagtgtattcgcaactctcctcagttcagatttgactggtttcttaagtccagaactgcaatggagctccagaggagatgtaataccttaattactttgattgaaagagaaaacatggaactagaagaaaaggagaaggcagagaaaaagaaacgaggaccaaagccttcaacacagaaacgtaaaatggatggcgcacctgatggtcgaggaagaaaaaagaagctgaaactatga
Sequence Length
3159
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
121,905 Da
NCBI Official Full Name
Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5, mRNA
NCBI Official Synonym Full Names
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
NCBI Official Symbol
SMARCA5
NCBI Official Synonym Symbols
ISWI; SNF2H; hISWI; hSNF2H; WCRF135
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5
UniProt Gene Name
SMARCA5
UniProt Synonym Gene Names
SNF2H; WCRF135; SWI/SNF-related matrix-associated actin-dependent regulator of chromatin A5; hSNF2H
UniProt Entry Name
SMCA5_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]

Uniprot Description

SMARCA5: an ubiquitous enzyme with ATP-dependent DNA helicase activity. Possesses intrinsic ATP-dependent nucleosome remodelling activity. Complexes containing SMARCA5 are capable of forming ordered nucleosome arrays on chromatin in vitro; this may require intact histone H4 tails. The catalytic subunit of the four known chromatin remodelling complexes: CHRAC, RSF, ACF/WCRF, and WICH. Each complex contains subunits which may regulate the specificity or catalytic activity of SMARCA5. Overexpressed in CD34-positive erythrocyte progenitor cells in acute myeloid leukemia. Down-regulation correlates with hematologic remission following chemotherapy. Belongs to the SNF2/RAD54 helicase family, ISWI subfamily.

Protein type: EC 3.6.4.-; EC 3.6.1.-; Helicase; Transcription factor; Histone-binding

Chromosomal Location of Human Ortholog: 4q31.1-q31.2

Cellular Component: condensed chromosome; nuclear replication fork; nucleolus; nucleoplasm; nucleus; RSF complex

Molecular Function: ATP binding; ATPase activity; DNA binding; histone binding; protein binding

Biological Process: ATP-dependent chromatin remodeling; chromatin remodeling; DNA replication-independent nucleosome assembly at centromere; nucleosome assembly; nucleosome positioning; positive regulation of gene expression, epigenetic; regulation of transcription from RNA polymerase II promoter; transcription initiation

Research Articles on SMARCA5

Similar Products

Product Notes

The SMARCA5 smarca5 (Catalog #AAA1272909) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtccg cggccgagcc tccgccaccc ccgcctcccg agagcgcgcc ttccaagccc gcagcctcga tcgccagcgg cgggagcaac agcagcaaca aaggcggccc cgaaggcgtc gcggcgcagg cggttgcgtc tgcggccagc gctggtcccg cagacgccga gatggaggaa atatttgatg atgcgtcacc tggaaagcaa aaggaaatcc aagaaccaga tcctacctat gaagaaaaaa tgcaaactga ccgggcaaat agattcgagt atttattaaa gcagacagaa ctttttgcac atttcattca acctgctgct cagaagactc caacttcacc tttgaagatg aaaccagggc gcccacgaat aaaaaaagat gagaagcaga acttactatc cgttggcgat taccgacacc gtagaacaga gcaagaggag gatgaagagc tattaacaga aagctccaaa gcaaccaatg tttgcactcg atttgaagac tctccatcgt atgtaaaatg gggtaaactg agagattatc aggtccgagg attaaactgg ctcatttctt tgtatgagaa tggcatcaat ggtatccttg cagatgaaat gggcctagga aagactcttc aaacaatttc tcttcttggg tacatgaaac attatagaaa cattcctggg cctcatatgg ttttggttcc taagtctaca ttacacaact ggatgagtga attcaagaga tgggtaccaa cacttagatc tgtttgtttg ataggagata aagaacaaag agctgctttt gtcagagacg ttttattacc gggagaatgg gatgtatgtg taacatctta tgaaatgctt attaaagaga agtctgtgtt caaaaaattt aattggagat acttagtaat agatgaagct cacaggatca aaaatgaaaa atctaagttg tcagaaatag tgagggaatt caagactaca aatagactat tattaactgg aacacctctt cagaacaact tgcatgagct gtggtcactt cttaactttc tgttgccaga tgtgtttaat tcagcagatg actttgattc ctggtttgat acaaacaact gccttgggga tcaaaaacta gttgagaggc ttcatatggt tttgcgtcca ttcctccttc gtcgaattaa ggctgatgtt gaaaagagtt tgcctccaaa gaaggaagta aaaatctatg tgggcctcag caaaatgcaa agggaatggt atactcggat attaatgaag gatatagata tactcaactc agcaggcaag atggacaaaa tgaggttatt gaacatccta atgcagttga gaaaatgttg taatcatcca tatctctttg atggagcaga acctggtcca ccttatacaa cagatatgca tctagtaacc aacagtggca aaatggtggt tttagacaag ctgctcccta agttaaaaga acaaggttca cgagtactaa tcttcagtca aatgacaagg gtattggaca ttttggaaga ttattgcatg tggagaaatt atgagtactg caggttggat ggtcagacac cccatgatga gagacaagac tccatcaatg catacaatga accaaacagc acaaagtttg ttttcatgtt aagcacgcgt gctggtggtc ttggcatcaa tcttgcgact gctgatgtag taattttgta tgattctgat tggaatcccc aagtagatct tcaggctatg gaccgagcac atagaattgg gcagactaag acagtcagag tgttccgctt tataactgat aacactgtag aagaaagaat agtagaacgt gctgagatga aactcagact ggattcaata gtcattcaac aagggaggct tgtggatcag aatctgaaca aaattgggaa agatgaaatg cttcaaatga ttagacatgg agcaacacat gtgtttgctt caaaggaaag tgagatcact gatgaagata tcgatggtat tttggaaaga ggtgcaaaga agactgcaga gatgaatgaa aagctctcca agatgggcga aagttcactt agaaacttta caatggatac agagtcaagt gtttataact tcgaaggaga agactataga gaaaaacaaa agattgcatt cacagagtgg attgaaccac ctaaacgaga aagaaaagcc aactatgccg ttgatgcata tttcagggaa gctcttcgtg ttagtgaacc taaagcaccc aaggctcctc gacctccaaa acaacccaat gttcaggatt tccagttctt tcctccacgt ttatttgaat tactggaaaa agaaattctg ttttacagaa aaactattgg gtacaaggta cctcgaaatc ctgagctgcc taacgcagca caggcacaaa aagaagaaca gcttaaaatt gatgaagctg aatcccttaa tgatgaagag ttagaggaaa aagagaagct tctaacacag ggatttacca attggaataa gagagatttt aaccagttta tcaaagctaa tgagaagtgg ggtcgtgatg atattgaaaa tatagcaaga gaagtagaag gcaaaactcc agaagaagtc attgaatatt cagctgtgtt ttgggaaagg tgcaacgagc tccaggacat agagaagatt atggctcaga ttgaaagggg agaggcgaga attcaaagaa gaataagcat caagaaagca cttgacacaa agattggacg gtacaaagca ccttttcatc agctgagaat atcatatggt actaacaaag gaaaaaacta tactgaagaa gaagatcgtt ttctgatttg tatgcttcac aaacttggat ttgacaaaga aaatgtttat gatgaattgc gacagtgtat tcgcaactct cctcagttca gatttgactg gtttcttaag tccagaactg caatggagct ccagaggaga tgtaatacct taattacttt gattgaaaga gaaaacatgg aactagaaga aaaggagaag gcagagaaaa agaaacgagg accaaagcct tcaacacaga aacgtaaaat ggatggcgca cctgatggtc gaggaagaaa aaagaagctg aaactatga. It is sometimes possible for the material contained within the vial of "SMARCA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.