Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMAD1 cdna clone

SMAD1 cDNA Clone

Gene Names
SMAD1; BSP1; JV41; BSP-1; JV4-1; MADH1; MADR1
Synonyms
SMAD1; SMAD1 cDNA Clone; SMAD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgtgacaagtttattttcctttacaagtccagctgtgaagagacttcttgggtggaaacagggcgatgaagaagaaaaatgggcagagaaagctgttgatgctttggtgaaaaaactgaagaaaaagaaaggtgccatggaggaactggaaaaggccttgagctgcccagggcaaccgagtaactgtgtcaccattccccgctctctggatggcaggctgcaagtctcccaccggaagggactgcctcatgtcatttactgccgtgtgtggcgctggcccgatcttcagagccaccatgaactaaaaccactggaatgctgtgagtttccttttggttccaagcagaaggaggtctgcatcaatccctaccactataagagagtagaaagccctgtacttcctcctgtgctggttccaagacacagcgaatataatcctcagcacagcctcttagctcagttccgtaacttaggacaaaatgagcctcacatgccactcaacgccacttttccagattctttccagcaacccaacagccacccgtttcctcactctcccaatagcagttacccaaactctcctgggagcagcagcagcacctaccctcactctcccaccagctcagacccaggaagccctttccagatgccagctgatacgcccccacctgcttacctgcctcctgaagaccccatgacccaggatggctctcagccgatggacacaaacatgatggcgcctcccctgccctcagaaatcaacagaggagatgttcaggcggttgcttatgaggaaccaaaacactggtgctctattgtctactatgagctcaacaatcgtgtgggtgaagcgttccatgcctcctccacaagtgtgttggtggatggtttcactgatccttccaacaataagaaccgtttctgccttgggctgctctccaatgttaaccggaattccactattgaaaacaccaggcggcatattggaaaaggagttcatctttattatgttggaggggaggtgtatgccgaatgccttagtgacagtagcatctttgtgcaaagtcggaactgcaactaccatcatggatttcatcctactactgtttgcaagatccctagtgggtgtagtctgaaaatttttaacaaccaagaatttgctcagttattggcacagtctgtgaaccatggatttgagacagtctatgagcttacaaaaatgtgtactatacgtatgagctttgtgaagggctggggagcagaataccaccgccaggatgttactagcaccccctgctggattgagatacatctgcacggccccctccagtggctggataaagttcttactcaaatgggttcacctcataatcctatttcatctgtatcttaa
Sequence Length
1398
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,406 Da
NCBI Official Full Name
Homo sapiens SMAD family member 1, mRNA
NCBI Official Synonym Full Names
SMAD family member 1
NCBI Official Symbol
SMAD1
NCBI Official Synonym Symbols
BSP1; JV41; BSP-1; JV4-1; MADH1; MADR1
NCBI Protein Information
mothers against decapentaplegic homolog 1
UniProt Protein Name
Mothers against decapentaplegic homolog 1
UniProt Gene Name
SMAD1
UniProt Synonym Gene Names
BSP1; MADH1; MADR1; MAD homolog 1; Mothers against DPP homolog 1; SMAD 1; Smad1; hSMAD1; BSP-1
UniProt Entry Name
SMAD1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]

Uniprot Description

SMAD1: transcription factor phosphorylated and activated by bone morphogenetic protein type 1 receptor kinases. Participates in a wide range of critical processes including morphogenesis, cell-fate determination, proliferation, differentiation and apoptosis. Phosphorylated forms dimerize with collaborating Smad4 and are translocated into the nucleus, where the transcription of target genes is stimulated.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 4q31

Cellular Component: cytoplasm; cytosol; nuclear inner membrane; nucleoplasm; nucleus; protein complex

Molecular Function: identical protein binding; protein binding; protein kinase binding; transcription factor activity; transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity

Biological Process: BMP signaling pathway; embryonic pattern specification; positive regulation of transcription from RNA polymerase II promoter; primary microRNA processing; SMAD protein complex assembly

Research Articles on SMAD1

Similar Products

Product Notes

The SMAD1 smad1 (Catalog #AAA1270688) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgtga caagtttatt ttcctttaca agtccagctg tgaagagact tcttgggtgg aaacagggcg atgaagaaga aaaatgggca gagaaagctg ttgatgcttt ggtgaaaaaa ctgaagaaaa agaaaggtgc catggaggaa ctggaaaagg ccttgagctg cccagggcaa ccgagtaact gtgtcaccat tccccgctct ctggatggca ggctgcaagt ctcccaccgg aagggactgc ctcatgtcat ttactgccgt gtgtggcgct ggcccgatct tcagagccac catgaactaa aaccactgga atgctgtgag tttccttttg gttccaagca gaaggaggtc tgcatcaatc cctaccacta taagagagta gaaagccctg tacttcctcc tgtgctggtt ccaagacaca gcgaatataa tcctcagcac agcctcttag ctcagttccg taacttagga caaaatgagc ctcacatgcc actcaacgcc acttttccag attctttcca gcaacccaac agccacccgt ttcctcactc tcccaatagc agttacccaa actctcctgg gagcagcagc agcacctacc ctcactctcc caccagctca gacccaggaa gccctttcca gatgccagct gatacgcccc cacctgctta cctgcctcct gaagacccca tgacccagga tggctctcag ccgatggaca caaacatgat ggcgcctccc ctgccctcag aaatcaacag aggagatgtt caggcggttg cttatgagga accaaaacac tggtgctcta ttgtctacta tgagctcaac aatcgtgtgg gtgaagcgtt ccatgcctcc tccacaagtg tgttggtgga tggtttcact gatccttcca acaataagaa ccgtttctgc cttgggctgc tctccaatgt taaccggaat tccactattg aaaacaccag gcggcatatt ggaaaaggag ttcatcttta ttatgttgga ggggaggtgt atgccgaatg ccttagtgac agtagcatct ttgtgcaaag tcggaactgc aactaccatc atggatttca tcctactact gtttgcaaga tccctagtgg gtgtagtctg aaaattttta acaaccaaga atttgctcag ttattggcac agtctgtgaa ccatggattt gagacagtct atgagcttac aaaaatgtgt actatacgta tgagctttgt gaagggctgg ggagcagaat accaccgcca ggatgttact agcaccccct gctggattga gatacatctg cacggccccc tccagtggct ggataaagtt cttactcaaa tgggttcacc tcataatcct atttcatctg tatcttaa. It is sometimes possible for the material contained within the vial of "SMAD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.