Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLU7 cdna clone

SLU7 cDNA Clone

Gene Names
SLU7; 9G8; hSlu7
Synonyms
SLU7; SLU7 cDNA Clone; SLU7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagccacagttgtagatgcagttaatgctgcacccctatcggggtccaaagaaatgagtttggaagaaccaaagaagatgaccagagaggactggagaaagaagaaggagctagaagaacagcgaaaattgggcaatgctcctgcagaagttgatgaagaaggaaaagacatcaacccccatattcctcagtatatttcttcagtgccatggtatattgatccttcaaaaagacctactttaaaacaccagagaccacaaccagaaaaacaaaagcagttcagctcatctggagaatggtacaagaggggtgtaaaagagaattccgtaattactaagtaccgcaaaggagcatgtgaaaattgtggggccatgacacacaaaaagaaagactgctttgagagacctaggcgagttggagccaaatttacaggtactaatatagctccagatgaacatgtccagcctcaactgatgtttgactatgatgggaagagggatcggtggaatggctacaatccagaagaacacatgaaaattgttgaagagtatgccaaagttgatttggcaaaacgaacattgaaagcccagaaactccaagaggaattagcctcaggaaaattagtggaacaggctaattctccaaaacaccagtggggagaagaggaaccaaattctcagacggaaaaagatcataatagtgaagatgaggatgaagataaatatgcagatgatattgacatgcctggacagaattttgactccaagagacgaattactgtccggaatctcaggattcgagaagatattgcaaaatatttgaggaatttagatccaaattctgcctactatgatccaaaaactagagcaatgagagagaatccttatgccaatgcaggaaagaatccagatgaagtgagttatgctggagataactttgttaggtacacaggagataccatttcaatggctcagacacagttgtttgcatgggaagcctatgacaagggatctgaagtgcatctacaggcagatcctacaaagctagagctgttgtataagtccttcaaagtcaaaaaagaagatttcaaagaacagcagaaagaaagcatcctggaaaagtatggtggccaagaacatttggatgcccctccagctgaattgcttttagcccagactgaagactatgtggagtactcaagacatgggacagtcatcaaaggacaggagcgggctgttgcctgctctaagtatgaggaggatgtgaagatccacaatcacacacatatctggggatcgtactggaaagaaggccgatggggatacaaatgctgtcactcttttttcaagtattcctattgtactggagaagctgggaaggagattgttaactctgaggagtgtattataaatgagataactggggaagaatctgtgaaaaaacctcaaaccctcatggagctgcatcaagaaaaactgaaagaggaaaagaagaagaagaaaaagaaaaagaagaagcatcgaaagagcagttcagatagtgatgatgaagaaaagaagcatgaaaaattgaaaaaggcactgaacgcagaggaggcccgccttcttcatgtcaaggagaccatgcagattgatgagaggaagcggccttacaatagcatgtatgaaactcgagaacctactgaagaggaaatggaggcatatagaatgaaacgtcagaggccagatgaccccatggcctctttccttggacagtag
Sequence Length
1761
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,387 Da
NCBI Official Full Name
Homo sapiens SLU7 splicing factor homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SLU7 homolog, splicing factor
NCBI Official Symbol
SLU7
NCBI Official Synonym Symbols
9G8; hSlu7
NCBI Protein Information
pre-mRNA-splicing factor SLU7
UniProt Protein Name
Pre-mRNA-splicing factor SLU7
Protein Family
UniProt Gene Name
SLU7
UniProt Synonym Gene Names
hSlu7
UniProt Entry Name
SLU7_HUMAN

NCBI Description

Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. [provided by RefSeq, Jul 2008]

Uniprot Description

SLU7: Participates in the second catalytic step of pre-mRNA splicing, when the free hydroxyl group of exon I attacks the 3'- splice site to generate spliced mRNA and the excised lariat intron. Required for holding exon 1 properly in the spliceosome and for correct AG identification when more than one possible AG exists in 3'-splicing site region. May be involved in the activation of proximal AG. Probably also involved in alternative splicing regulation. Belongs to the SLU7 family.

Protein type: RNA splicing; RNA processing; Spliceosome

Chromosomal Location of Human Ortholog: 5q33.3

Cellular Component: cytoplasm; intracellular membrane-bound organelle; membrane; nuclear speck; nucleoplasm; nucleus; small nuclear ribonucleoprotein complex; spliceosome

Molecular Function: pre-mRNA 3'-splice site binding; protein binding; second spliceosomal transesterification activity; zinc ion binding

Biological Process: alternative nuclear mRNA splicing, via spliceosome; intracellular protein transport; mRNA 3'-end processing; mRNA export from nucleus; nuclear mRNA 3'-splice site recognition; nuclear mRNA splicing, via spliceosome; RNA export from nucleus; RNA splicing, via transesterification reactions; termination of RNA polymerase II transcription

Research Articles on SLU7

Similar Products

Product Notes

The SLU7 slu7 (Catalog #AAA1265987) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagcca cagttgtaga tgcagttaat gctgcacccc tatcggggtc caaagaaatg agtttggaag aaccaaagaa gatgaccaga gaggactgga gaaagaagaa ggagctagaa gaacagcgaa aattgggcaa tgctcctgca gaagttgatg aagaaggaaa agacatcaac ccccatattc ctcagtatat ttcttcagtg ccatggtata ttgatccttc aaaaagacct actttaaaac accagagacc acaaccagaa aaacaaaagc agttcagctc atctggagaa tggtacaaga ggggtgtaaa agagaattcc gtaattacta agtaccgcaa aggagcatgt gaaaattgtg gggccatgac acacaaaaag aaagactgct ttgagagacc taggcgagtt ggagccaaat ttacaggtac taatatagct ccagatgaac atgtccagcc tcaactgatg tttgactatg atgggaagag ggatcggtgg aatggctaca atccagaaga acacatgaaa attgttgaag agtatgccaa agttgatttg gcaaaacgaa cattgaaagc ccagaaactc caagaggaat tagcctcagg aaaattagtg gaacaggcta attctccaaa acaccagtgg ggagaagagg aaccaaattc tcagacggaa aaagatcata atagtgaaga tgaggatgaa gataaatatg cagatgatat tgacatgcct ggacagaatt ttgactccaa gagacgaatt actgtccgga atctcaggat tcgagaagat attgcaaaat atttgaggaa tttagatcca aattctgcct actatgatcc aaaaactaga gcaatgagag agaatcctta tgccaatgca ggaaagaatc cagatgaagt gagttatgct ggagataact ttgttaggta cacaggagat accatttcaa tggctcagac acagttgttt gcatgggaag cctatgacaa gggatctgaa gtgcatctac aggcagatcc tacaaagcta gagctgttgt ataagtcctt caaagtcaaa aaagaagatt tcaaagaaca gcagaaagaa agcatcctgg aaaagtatgg tggccaagaa catttggatg cccctccagc tgaattgctt ttagcccaga ctgaagacta tgtggagtac tcaagacatg ggacagtcat caaaggacag gagcgggctg ttgcctgctc taagtatgag gaggatgtga agatccacaa tcacacacat atctggggat cgtactggaa agaaggccga tggggataca aatgctgtca ctcttttttc aagtattcct attgtactgg agaagctggg aaggagattg ttaactctga ggagtgtatt ataaatgaga taactgggga agaatctgtg aaaaaacctc aaaccctcat ggagctgcat caagaaaaac tgaaagagga aaagaagaag aagaaaaaga aaaagaagaa gcatcgaaag agcagttcag atagtgatga tgaagaaaag aagcatgaaa aattgaaaaa ggcactgaac gcagaggagg cccgccttct tcatgtcaag gagaccatgc agattgatga gaggaagcgg ccttacaata gcatgtatga aactcgagaa cctactgaag aggaaatgga ggcatataga atgaaacgtc agaggccaga tgaccccatg gcctctttcc ttggacagta g. It is sometimes possible for the material contained within the vial of "SLU7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.