Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLCO1C1 cdna clone

SLCO1C1 cDNA Clone

Gene Names
SLCO1C1; OATP1; OATPF; OATP-F; OATP14; OATP1C1; OATPRP5; SLC21A14
Synonyms
SLCO1C1; SLCO1C1 cDNA Clone; SLCO1C1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacacttcatccaaagaaaatatccagttgttctgcaaaacttcagtgcaacctgttggaaggccttcttttaaaacagaatatccgtcctcagaagaaaagcaaccatgctgtggtgaactaaaggtgttcttgtgtgccttgtcttttgtttactttgccaaagcattggcagaaggctatctgaagagcaccatcactcagatagagagaaggtttgatatcccttcttcactggtgggagttattgatggtagttttgaaattgggaatctcttagttataacatttgttagctactttggagccaaacttcacaggccaaaaataattggagcagggtgtgtaatcatgggagttggaacactgctaattgcaatgcctcagttcttcatggagcagtacaaatatgagagatattctccttcctccaattccactctcagcatctctccgtgtctcctagagtcaagcagtcaattaccagtttcagttatggaaaaatcaaaatccaaaataagtaacgaatgtgaagtggacactagctcttccatgtggatttatgttttcctgggcaatcttcttcgtggaataggagaaactcccattcagcctttgggcattgcctacctggatgattttgccagtgaagacaatgcagctttctatattgggtgtgtgcagacggttgcaattataggaccaatctttggtttcctgttaggctcattatgtgccaaactatatgttgacattggctttgtaaacctagatcacataaccattaccccaaaagatccccagtgggtaggagcctggtggcttggctatctaatagcaggaatcataagtcttcttgcagctgtgcctttctggtatttaccaaagagtttaccaagatcccaaagtagagaggattctaattcttcctctgagaaatccaagtttattatagatgatcacacagactaccaaacaccccagggagaaaatgcaaaaataatggaaatggcaagagattttcttccatcactgaagaatctttttggaaacccagtatacttcctatatttatgtacaagcactgttcagttcaattctctgttcggcatggtgacgtacaaaccaaagtacattgagcagcagtatggacagtcatcctccagggccaactttgtgatcgggctcatcaacattccagcagtggcccttggaatattctctggggggatagttatgaaaaaattcagaatcagtgtgtgtggagctgcaaaactctacttgggatcatctgtctttggttacctcctatttctttccctgtttgcactgggctgtgaaaattctgatgtggcaggactaactgtctcctaccaaggaaccaaacctgtctcttatcatgaacgagctctcttttcagattgcaactcaagatgcaaatgttcagagacaaaatgggaacccatgtgcggtgaaaatggaatcacatatgtatcagcttgtcttgctggttgtcaaacctccaacaggagtggaaaaaatattatattttacaactgcacttgtgtgggaattgcagcttctaaatccggaaattcctcaggcatagtgggaagatgtcagaaagacaatggatgtccccaaatgtttctgtatttccttgtaatttcagtcatcacatcctatactttatccctaggtggcatacctggatacatattacttctgaggtgcattaagccacagcttaagtcttttgccttgggtatctacacattagcaataagagttcttgcaggaatcccagctccagtgtattttggagttttgattgatacttcatgcctcaaatggggatttaaaagatgtggaagtagaggatcatgcagattatatgattcaaatgtcttcagacatatatatttgggactaactgtgatactgggcacagtgtcaattctcctaagcattgcagtacttttcattttaaagaaaaattatgtttcaaaacacagaagttttataaccaagagagaaagaacaatggtgtctacaagattccaaaaggaaaattacactacaagtgatcatctgctacaacccaactactggccaggcaaggaaactcaactttag
Sequence Length
2139
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,677 Da
NCBI Official Full Name
Homo sapiens solute carrier organic anion transporter family, member 1C1, mRNA
NCBI Official Synonym Full Names
solute carrier organic anion transporter family member 1C1
NCBI Official Symbol
SLCO1C1
NCBI Official Synonym Symbols
OATP1; OATPF; OATP-F; OATP14; OATP1C1; OATPRP5; SLC21A14
NCBI Protein Information
solute carrier organic anion transporter family member 1C1
UniProt Protein Name
Solute carrier organic anion transporter family member 1C1
UniProt Gene Name
SLCO1C1
UniProt Synonym Gene Names
OATP14; OATP1C1; OATPF; SLC21A14; OATP-F; OAT-RP-5; OATPRP5; OATP-14
UniProt Entry Name
SO1C1_HUMAN

NCBI Description

This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

Uniprot Description

SLCO1C1: Mediates the Na(+)-independent high affinity transport of organic anions such as the thyroid hormones thyroxine (T4) and rT3. Other potential substrates, such as triiodothyronine (T3), 17-beta-glucuronosyl estradiol, estrone-3-sulfate and sulfobromophthalein (BSP) are transported with much lower efficiency. May play a signifiant role in regulating T4 flux into and out of the brain. Belongs to the organo anion transporter (TC 2.A.60) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, SLC family; Membrane protein, multi-pass; Transporter; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p12.2

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: bile acid transmembrane transporter activity; sodium-independent organic anion transmembrane transporter activity; thyroid hormone transmembrane transporter activity

Biological Process: bile acid metabolic process; sodium-independent organic anion transport

Research Articles on SLCO1C1

Similar Products

Product Notes

The SLCO1C1 slco1c1 (Catalog #AAA1272356) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacactt catccaaaga aaatatccag ttgttctgca aaacttcagt gcaacctgtt ggaaggcctt cttttaaaac agaatatccg tcctcagaag aaaagcaacc atgctgtggt gaactaaagg tgttcttgtg tgccttgtct tttgtttact ttgccaaagc attggcagaa ggctatctga agagcaccat cactcagata gagagaaggt ttgatatccc ttcttcactg gtgggagtta ttgatggtag ttttgaaatt gggaatctct tagttataac atttgttagc tactttggag ccaaacttca caggccaaaa ataattggag cagggtgtgt aatcatggga gttggaacac tgctaattgc aatgcctcag ttcttcatgg agcagtacaa atatgagaga tattctcctt cctccaattc cactctcagc atctctccgt gtctcctaga gtcaagcagt caattaccag tttcagttat ggaaaaatca aaatccaaaa taagtaacga atgtgaagtg gacactagct cttccatgtg gatttatgtt ttcctgggca atcttcttcg tggaatagga gaaactccca ttcagccttt gggcattgcc tacctggatg attttgccag tgaagacaat gcagctttct atattgggtg tgtgcagacg gttgcaatta taggaccaat ctttggtttc ctgttaggct cattatgtgc caaactatat gttgacattg gctttgtaaa cctagatcac ataaccatta ccccaaaaga tccccagtgg gtaggagcct ggtggcttgg ctatctaata gcaggaatca taagtcttct tgcagctgtg cctttctggt atttaccaaa gagtttacca agatcccaaa gtagagagga ttctaattct tcctctgaga aatccaagtt tattatagat gatcacacag actaccaaac accccaggga gaaaatgcaa aaataatgga aatggcaaga gattttcttc catcactgaa gaatcttttt ggaaacccag tatacttcct atatttatgt acaagcactg ttcagttcaa ttctctgttc ggcatggtga cgtacaaacc aaagtacatt gagcagcagt atggacagtc atcctccagg gccaactttg tgatcgggct catcaacatt ccagcagtgg cccttggaat attctctggg gggatagtta tgaaaaaatt cagaatcagt gtgtgtggag ctgcaaaact ctacttggga tcatctgtct ttggttacct cctatttctt tccctgtttg cactgggctg tgaaaattct gatgtggcag gactaactgt ctcctaccaa ggaaccaaac ctgtctctta tcatgaacga gctctctttt cagattgcaa ctcaagatgc aaatgttcag agacaaaatg ggaacccatg tgcggtgaaa atggaatcac atatgtatca gcttgtcttg ctggttgtca aacctccaac aggagtggaa aaaatattat attttacaac tgcacttgtg tgggaattgc agcttctaaa tccggaaatt cctcaggcat agtgggaaga tgtcagaaag acaatggatg tccccaaatg tttctgtatt tccttgtaat ttcagtcatc acatcctata ctttatccct aggtggcata cctggataca tattacttct gaggtgcatt aagccacagc ttaagtcttt tgccttgggt atctacacat tagcaataag agttcttgca ggaatcccag ctccagtgta ttttggagtt ttgattgata cttcatgcct caaatgggga tttaaaagat gtggaagtag aggatcatgc agattatatg attcaaatgt cttcagacat atatatttgg gactaactgt gatactgggc acagtgtcaa ttctcctaag cattgcagta cttttcattt taaagaaaaa ttatgtttca aaacacagaa gttttataac caagagagaa agaacaatgg tgtctacaag attccaaaag gaaaattaca ctacaagtga tcatctgcta caacccaact actggccagg caaggaaact caactttag. It is sometimes possible for the material contained within the vial of "SLCO1C1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.