Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC9A1 cdna clone

SLC9A1 cDNA Clone

Gene Names
SLC9A1; APNH; NHE1; LIKNS; NHE-1; PPP1R143
Synonyms
SLC9A1; SLC9A1 cDNA Clone; SLC9A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggttctgcggtctggcatctgtggcctctctccacatcggatcttcccttccttactcgtggtggttgctttggtggggctgctgcctgttctcaggagccatggcctccagctcagcccaactgccagcaccattcgaagctcagagccaccacgagaacgctcgattggggatgtcaccaccgctccaccggaggtcaccccagagagccgccctgttaatcattccgtcactgatcatggcatgaagccgcgcaaggcctttccagtcctgggcatcgactacacacacgtgcgcacccccttcgagatctccctctggatccttctggcctgcctcatgaagataggtttccatgtgatccccactatctcaagcatcgtcccggagagctgcctgctgatcgtggtggggctgctggtggggggcctgatcaagggtgtaggcgagacaccccccttcctgcagtccgacgtcttcttcctcttcctgctgccgcccatcatcctggatgcgggctacttcctgccactgcggcagttcacagaaaacctgggcaccatcctgatctttgccgtggtgggcacgctgtggaacgccttcttcctgggcggcctcatgtacgccgtgtgcctggtgggcggtgagcagatcaacaacatcggcctcctggacaacctgctcttcggcagcatcatctcggccgtggaccccgtggcggttctggctgtctttgaggaaattcacatcaatgagctgctgcacatccttgtttttggggagtccttgctcaatgacgccgtcactgtggtcctgtatcacctctttgaggagtttgccaactacgaacacgtgggcatcgtggacatcttcctcggcttcctgagcttcttcgtggtggccctgggcggggtgcttgtgggcgtggtctacggggtcatcgcagccttcacctcccgatttacctcccacatccgggtcatcgagccgctcttcgtcttcctctacagctacatggcctacttgtcagccgagctcttccacctgtcaggcatcatggcgctcatagcctcaggagtggtgatgcgcccctatgtggaggccaacatctcccacaagtcccacaccaccatcaaatacttcctgaagatgtggagcagcgtcagcgagaccctcatcttcatcttcctcggcgtctccacggtggccggctcccaccactggaactggaccttcgtcatcagcaccctgctcttctgcctcatcgcccgcgtgctgggggtgctgggcctgacctggttcatcaacaagttccgtatcgtgaagctgacccccaaggaccagttcatcatcgcctatgggggcctgcgaggggccatcgccttctctctgggctacctcctggacaagaagcacttccccatgtgtgacctgttcctcactgccatcatcactgtcatcttcttcaccgtctttgtgcaggtgctgggccagggcagggcaggcccttgccttggggaccctcacaggctgttcccgtggaaagagaggaaagcgtgtgatttgaaatgcgattctagtcccagctccaccactaacttgctgtgtgaccttgggcgagccactccccctttctgggcctcagtttcttcaatcgtaaagtga
Sequence Length
1668
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,013 Da
NCBI Official Full Name
Homo sapiens solute carrier family 9 (sodium/hydrogen exchanger), member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 9 member A1
NCBI Official Symbol
SLC9A1
NCBI Official Synonym Symbols
APNH; NHE1; LIKNS; NHE-1; PPP1R143
NCBI Protein Information
sodium/hydrogen exchanger 1
UniProt Protein Name
Sodium/hydrogen exchanger 1
Protein Family
UniProt Gene Name
SLC9A1
UniProt Synonym Gene Names
APNH1; NHE1; NHE-1
UniProt Entry Name
SL9A1_HUMAN

NCBI Description

This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]

Uniprot Description

NHE1: sodium/hydrogen exchanger 1. Belongs to the Na(+)/H(+) exchanger family. Involved in pH regulation to eliminate acids generated by active metabolism or to counter adverse environmental conditions. Major proton extruding system driven by the inward sodium ion chemical gradient.

Protein type: Motility/polarity/chemotaxis; Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass; Transporter

Chromosomal Location of Human Ortholog: 1p36.1-p35

Cellular Component: cytoplasm; endoplasmic reticulum; focal adhesion; integral to membrane; integral to plasma membrane; lamellipodium; lipid raft; nucleoplasm; plasma membrane

Molecular Function: calcium-dependent protein binding; phosphatidylinositol-4,5-bisphosphate binding; potassium:hydrogen antiporter activity; protein binding; protein binding, bridging; protein complex scaffold; protein phosphatase 2B binding; sodium:hydrogen antiporter activity; solute:hydrogen antiporter activity

Biological Process: cell migration; cellular sodium ion homeostasis; hyaluronan catabolic process; ion transport; maintenance of cell polarity; positive regulation of NFAT protein import into nucleus; positive regulation of transcription from RNA polymerase II promoter; protein oligomerization; regulation of focal adhesion formation; regulation of intracellular pH; regulation of pH; regulation of stress fiber formation; response to acidity

Disease: Lichtenstein-knorr Syndrome

Research Articles on SLC9A1

Similar Products

Product Notes

The SLC9A1 slc9a1 (Catalog #AAA1273518) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttctgc ggtctggcat ctgtggcctc tctccacatc ggatcttccc ttccttactc gtggtggttg ctttggtggg gctgctgcct gttctcagga gccatggcct ccagctcagc ccaactgcca gcaccattcg aagctcagag ccaccacgag aacgctcgat tggggatgtc accaccgctc caccggaggt caccccagag agccgccctg ttaatcattc cgtcactgat catggcatga agccgcgcaa ggcctttcca gtcctgggca tcgactacac acacgtgcgc acccccttcg agatctccct ctggatcctt ctggcctgcc tcatgaagat aggtttccat gtgatcccca ctatctcaag catcgtcccg gagagctgcc tgctgatcgt ggtggggctg ctggtggggg gcctgatcaa gggtgtaggc gagacacccc ccttcctgca gtccgacgtc ttcttcctct tcctgctgcc gcccatcatc ctggatgcgg gctacttcct gccactgcgg cagttcacag aaaacctggg caccatcctg atctttgccg tggtgggcac gctgtggaac gccttcttcc tgggcggcct catgtacgcc gtgtgcctgg tgggcggtga gcagatcaac aacatcggcc tcctggacaa cctgctcttc ggcagcatca tctcggccgt ggaccccgtg gcggttctgg ctgtctttga ggaaattcac atcaatgagc tgctgcacat ccttgttttt ggggagtcct tgctcaatga cgccgtcact gtggtcctgt atcacctctt tgaggagttt gccaactacg aacacgtggg catcgtggac atcttcctcg gcttcctgag cttcttcgtg gtggccctgg gcggggtgct tgtgggcgtg gtctacgggg tcatcgcagc cttcacctcc cgatttacct cccacatccg ggtcatcgag ccgctcttcg tcttcctcta cagctacatg gcctacttgt cagccgagct cttccacctg tcaggcatca tggcgctcat agcctcagga gtggtgatgc gcccctatgt ggaggccaac atctcccaca agtcccacac caccatcaaa tacttcctga agatgtggag cagcgtcagc gagaccctca tcttcatctt cctcggcgtc tccacggtgg ccggctccca ccactggaac tggaccttcg tcatcagcac cctgctcttc tgcctcatcg cccgcgtgct gggggtgctg ggcctgacct ggttcatcaa caagttccgt atcgtgaagc tgacccccaa ggaccagttc atcatcgcct atgggggcct gcgaggggcc atcgccttct ctctgggcta cctcctggac aagaagcact tccccatgtg tgacctgttc ctcactgcca tcatcactgt catcttcttc accgtctttg tgcaggtgct gggccagggc agggcaggcc cttgccttgg ggaccctcac aggctgttcc cgtggaaaga gaggaaagcg tgtgatttga aatgcgattc tagtcccagc tccaccacta acttgctgtg tgaccttggg cgagccactc cccctttctg ggcctcagtt tcttcaatcg taaagtga. It is sometimes possible for the material contained within the vial of "SLC9A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.