Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC6A6 cdna clone

SLC6A6 cDNA Clone

Gene Names
SLC6A6; TAUT
Synonyms
SLC6A6; SLC6A6 cDNA Clone; SLC6A6 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaccaaggagaagctgcagtgtctgaaagatttccacaaggacatcctgaagccctcaccagggaagagcccaggcacgcggcctgaggacgaggctgagggaaaacctccgcagagggagaagtggtctagcaagatcgactttgtgctctctgtggctggcggcttcgtgggcttgggcaacgtctggcgcttcccgtacctctgctacaagaatggtggaggtgcgtttctcataccgtattttattttcctgtttgggagcggcctgcctgtgtttttcttggagatcatcataggccagtacacctctgaagggggcatcacctgctgggaaaagatctgccccttgttctctggtatcggctatgcctccgttgtaattgtgtccctcctgaatgtctactacatcgtcatcctggcctgggccacatactacctgttccagtccttccagaaggagctgccctgggcacactgcaaccacagctggaacacacctcactgcatggaggacaccatgcgcaagaacaagagtgtctggatcaccatcagctccaccaacttcacctcccctgtcatcgagttctgggagtaa
Sequence Length
603
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,744 Da
NCBI Official Full Name
Homo sapiens solute carrier family 6 (neurotransmitter transporter, taurine), member 6, mRNA
NCBI Official Synonym Full Names
solute carrier family 6 member 6
NCBI Official Symbol
SLC6A6
NCBI Official Synonym Symbols
TAUT
NCBI Protein Information
sodium- and chloride-dependent taurine transporter
UniProt Protein Name
Sodium- and chloride-dependent taurine transporter
UniProt Gene Name
SLC6A6
UniProt Entry Name
SC6A6_HUMAN

NCBI Description

This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Uniprot Description

TAUT: Required for the uptake of taurine. Transports both taurine and beta-alanine which requires sodium ions. Chloride ions are necessary for optimal uptake. Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A6 subfamily.

Protein type: Membrane protein, integral; Transporter; Transporter, SLC family; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3p25.1

Cellular Component: integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: amino acid transmembrane transporter activity

Biological Process: amino acid metabolic process; amino acid transport; taurine transport; transport

Research Articles on SLC6A6

Similar Products

Product Notes

The SLC6A6 slc6a6 (Catalog #AAA1276930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacca aggagaagct gcagtgtctg aaagatttcc acaaggacat cctgaagccc tcaccaggga agagcccagg cacgcggcct gaggacgagg ctgagggaaa acctccgcag agggagaagt ggtctagcaa gatcgacttt gtgctctctg tggctggcgg cttcgtgggc ttgggcaacg tctggcgctt cccgtacctc tgctacaaga atggtggagg tgcgtttctc ataccgtatt ttattttcct gtttgggagc ggcctgcctg tgtttttctt ggagatcatc ataggccagt acacctctga agggggcatc acctgctggg aaaagatctg ccccttgttc tctggtatcg gctatgcctc cgttgtaatt gtgtccctcc tgaatgtcta ctacatcgtc atcctggcct gggccacata ctacctgttc cagtccttcc agaaggagct gccctgggca cactgcaacc acagctggaa cacacctcac tgcatggagg acaccatgcg caagaacaag agtgtctgga tcaccatcag ctccaccaac ttcacctccc ctgtcatcga gttctgggag taa. It is sometimes possible for the material contained within the vial of "SLC6A6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.