Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC5A10 cdna clone

SLC5A10 cDNA Clone

Gene Names
SLC5A10; SGLT5; SGLT-5
Synonyms
SLC5A10; SLC5A10 cDNA Clone; SLC5A10 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgtggtggccgattggagcctccctcttcgccagcagcgagggctctggcctcttcattggactggcgggctcaggcgcggcaggaggtctggccgtggcaggcttcgagtggaatgccacgtacgtgctgctggcactggcatgggtgttcgtgcccatctacatctcctcagagatcgtcaccttacctgagtacattcagaagcgctacgggggccagcggatccgcatgtacctgtctgtcctgtccctgctactgtctgtcttcaccaagatatcgctggacctgtacgcgggggctctgtttgtgcacatctgcctgggctggaacttctacctctccaccatcctcacgctcggcatcacagccctgtacaccatcgcagcttttgaccagatcggtggttacgggcagctggaggcagcctacgcccaggccattccctccaggaccattgccaacaccacctgccacctgccacgtacagacgccatgcacatgtttcgagacccccacacaggggacctgccgtggaccgggatgacctttggcctgaccatcatggccacctggtactggtgcaccgaccaggtcatcgtgcagcgatcactgtcagcccgggacctgaaccatgccaaggcgggctccatcctggccagctacctcaagatgctccccatgggcctgatcatcatgccgggcatgatcagccgcgcattgttcccaggtgctcatgtctatgaggagagacaccaagtgtccgtctctcgaacagatgatgtgggctgcgtggtgccgtccgagtgcctgcgggcctgcggggccgaggtcggctgctccaacatcgcctaccccaagctggtcatggaactgatgcccatcggtctgcgggggctgatgatcgcagtgatgctggcggcgctcatgtcgtcgctgacctccatcttcaacagcagcagcaccctcttcactatggacatctggaggcggctgcgtccccgctccggcgagcgggagctcctgctggtgggacgcactgggataccctcaacacccccagcccctcaaagccgtctcagcttcctcctgcccgaaacaccaccattggagcggtatctcctaggcctcgtggtcatggatctctggctggtcatagtggcactcatcggcgtgagtgtggcctggatccccgtcctgcaggactccaacagcgggcaactcttcatctacatgcagtcagtgaccagctccctggccccaccagtgactgcagtctttgtcctgggcgtcttctggcgacgtgccaacgagcagggggccttctggggcctgatagcagggctggtggtgggggccacgaggctggtcctggaattcctgaacccagccccaccgtgcggagagccagacacgcggccagccgtcctggggagcatccactacctgcacttcgctgtcgccctctttgcactcagtggtgctgttgtggtggctggaagcctgctgaccccacccccacagagtgtccagattgagaaccttacctggtggaccctggctcaggatgtgcccttgggaactaaagcaggtgatggccaaacaccccagaaacacgccttctgggcccgtgtctgtggcttcaatgccatcctcctcatgtgtgtcaacatattcttttatgcctacttcgcctga
Sequence Length
1701
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,577 Da
NCBI Official Full Name
Homo sapiens solute carrier family 5 (sodium/glucose cotransporter), member 10, mRNA
NCBI Official Synonym Full Names
solute carrier family 5 member 10
NCBI Official Symbol
SLC5A10
NCBI Official Synonym Symbols
SGLT5; SGLT-5
NCBI Protein Information
sodium/glucose cotransporter 5
UniProt Protein Name
Sodium/glucose cotransporter 5
UniProt Gene Name
SLC5A10
UniProt Synonym Gene Names
SGLT5; Na(+)/glucose cotransporter 5
UniProt Entry Name
SC5AA_HUMAN

NCBI Description

This gene is a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

SLC5A10: a member of the sodium/glucose transporter family. Members of this family are sodium-dependent transporters and can be divided into two subfamilies based on sequence homology, one that co-transports sugars and the second that transports molecules such as ascorbate, choline, iodide, lipoate, monocaroboxylates, and pantothenate. The protein encoded by this gene has the highest affinity for mannose and has been reported to be most highly expressed in the kidney. This protein may function as a kidney-specific, sodium-dependent mannose and fructose co-transporter. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p11.2

Cellular Component: integral to plasma membrane

Molecular Function: symporter activity

Research Articles on SLC5A10

Similar Products

Product Notes

The SLC5A10 slc5a10 (Catalog #AAA1268171) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgtggt ggccgattgg agcctccctc ttcgccagca gcgagggctc tggcctcttc attggactgg cgggctcagg cgcggcagga ggtctggccg tggcaggctt cgagtggaat gccacgtacg tgctgctggc actggcatgg gtgttcgtgc ccatctacat ctcctcagag atcgtcacct tacctgagta cattcagaag cgctacgggg gccagcggat ccgcatgtac ctgtctgtcc tgtccctgct actgtctgtc ttcaccaaga tatcgctgga cctgtacgcg ggggctctgt ttgtgcacat ctgcctgggc tggaacttct acctctccac catcctcacg ctcggcatca cagccctgta caccatcgca gcttttgacc agatcggtgg ttacgggcag ctggaggcag cctacgccca ggccattccc tccaggacca ttgccaacac cacctgccac ctgccacgta cagacgccat gcacatgttt cgagaccccc acacagggga cctgccgtgg accgggatga cctttggcct gaccatcatg gccacctggt actggtgcac cgaccaggtc atcgtgcagc gatcactgtc agcccgggac ctgaaccatg ccaaggcggg ctccatcctg gccagctacc tcaagatgct ccccatgggc ctgatcatca tgccgggcat gatcagccgc gcattgttcc caggtgctca tgtctatgag gagagacacc aagtgtccgt ctctcgaaca gatgatgtgg gctgcgtggt gccgtccgag tgcctgcggg cctgcggggc cgaggtcggc tgctccaaca tcgcctaccc caagctggtc atggaactga tgcccatcgg tctgcggggg ctgatgatcg cagtgatgct ggcggcgctc atgtcgtcgc tgacctccat cttcaacagc agcagcaccc tcttcactat ggacatctgg aggcggctgc gtccccgctc cggcgagcgg gagctcctgc tggtgggacg cactgggata ccctcaacac ccccagcccc tcaaagccgt ctcagcttcc tcctgcccga aacaccacca ttggagcggt atctcctagg cctcgtggtc atggatctct ggctggtcat agtggcactc atcggcgtga gtgtggcctg gatccccgtc ctgcaggact ccaacagcgg gcaactcttc atctacatgc agtcagtgac cagctccctg gccccaccag tgactgcagt ctttgtcctg ggcgtcttct ggcgacgtgc caacgagcag ggggccttct ggggcctgat agcagggctg gtggtggggg ccacgaggct ggtcctggaa ttcctgaacc cagccccacc gtgcggagag ccagacacgc ggccagccgt cctggggagc atccactacc tgcacttcgc tgtcgccctc tttgcactca gtggtgctgt tgtggtggct ggaagcctgc tgaccccacc cccacagagt gtccagattg agaaccttac ctggtggacc ctggctcagg atgtgccctt gggaactaaa gcaggtgatg gccaaacacc ccagaaacac gccttctggg cccgtgtctg tggcttcaat gccatcctcc tcatgtgtgt caacatattc ttttatgcct acttcgcctg a. It is sometimes possible for the material contained within the vial of "SLC5A10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.