Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC4A4 cdna clone

SLC4A4 cDNA Clone

Gene Names
SLC4A4; KNBC; NBC1; NBC2; pNBC; HNBC1; hhNMC; kNBC1; SLC4A5; NBCe1-A
Synonyms
SLC4A4; SLC4A4 cDNA Clone; SLC4A4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccactgaaaatgtggaagggaagcccagtaaccttggggagagaggaagagcccggagctccactttcctcagggttgtccagccaatgtttaaccacagtattttcacttctgcagtctctcctgctgcagaacgcatccgattcatcttgggagaggaggatgacagcccagctccccctcagctcttcacggaactggatgagctgctggccgtggatgggcaggagatggagtggaaggaaacagccaggtggatcaagtttgaagaaaaagtggaacagggtggggaaagatggagcaagccccatgtggccacattgtcccttcatagtttatttgagctgaggacatgtatggagaaaggatccatcatgcttgatcgggaggcttcttctctcccacagttggtggagatgattgttgaccatcagattgagacaggcctattgaaacctgaacttaaggataaggtgacctatactttgctccggaagcaccggcatcaaaccaagaaatccaaccttcggtccctggctgacattgggaagacagtctccagtgcaagtaggatgtttaccaaccctgataatggtagcccagccatgacccataggaatctgacttcctccagtctgaatgacatttctgataaaccggagaaggaccagctgaagaataagttcatgaaaaaattgccacgtgatgcagaagcttccaacgtgcttgttggggaggttgactttttggatactcctttcattgcctttgttaggctacagcaggctgtcatgctgggtgccctgactgaagttcctgtgcccacaaggttcttgttcattctcttaggtcctaaggggaaagccaagtcctaccacgagattggcagagccattgccaccctgatgtctgatgaggtgttccatgacattgcttataaagcaaaagacaggcacgacctgattgctggtattgatgagttcctagatgaagtcatcgtccttccacctggggaatgggatccagcaattaggatagagcctcctaagagtcttccatcctctgacaaaagaaagaatatgtactcaggtggagagaatgttcagatgaatggggatacgccccatgatggaggtcacggaggaggaggacatggggattgtgaagaattgcagcgaactggacggttctgtggtggactaattaaagacataaagaggaaagcgccattttttgccagtgatttttatgatgctttaaatattcaagctctttcggcaattctcttcatttatctggcaactgtaactaatgctatcacttttggaggactgcttggggatgccactgacaacatgcagggcgtgttggagagtttcctgggcactgctgtctctggagccatcttttgcctttttgctggtcaaccactcactattctgagcagcaccggacctgtcctagtttttgagaggcttctatttaatttcagcaaggacaataattttgactatttggagtttcgcctttggattggcctgtggtccgccttcctatgtctcattttggtagccactgatgccagcttcttggttcaatacttcacacgtttcacggaggagggcttttcctctctgattagcttcatctttatctatgatgctttcaagaagatgatcaagcttgcagattactaccccatcaactccaacttcaaagtgggctacaacactctcttttcctgtacctgtgtgccacctgacccaggtgagggcattacgctttgtgtttatgctcgctttgtatttggaggaaggtgtaggctccatgcttgcaaattttcaacatgctgtcatggtcctcaggaattagtcttgtttttttctctgaaaaactctgctactgaatttgatgtctcattgcctgaggtattttag
Sequence Length
1941
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
123,181 Da
NCBI Official Full Name
Homo sapiens solute carrier family 4, sodium bicarbonate cotransporter, member 4, mRNA
NCBI Official Synonym Full Names
solute carrier family 4 member 4
NCBI Official Symbol
SLC4A4
NCBI Official Synonym Symbols
KNBC; NBC1; NBC2; pNBC; HNBC1; hhNMC; kNBC1; SLC4A5; NBCe1-A
NCBI Protein Information
electrogenic sodium bicarbonate cotransporter 1
UniProt Protein Name
Electrogenic sodium bicarbonate cotransporter 1
UniProt Gene Name
SLC4A4
UniProt Synonym Gene Names
NBC; NBC1; NBCE1; Sodium bicarbonate cotransporter
UniProt Entry Name
S4A4_HUMAN

NCBI Description

This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]

Uniprot Description

SLC4A4: Electrogenic sodium/bicarbonate cotransporter with a Na(+):HCO3(-) stoichiometry varying from 1:2 to 1:3. May regulate bicarbonate influx/efflux at the basolateral membrane of cells and regulate intracellular pH. Defects in SLC4A4 are the cause of proximal renal tubular acidosis with ocular abnormalities (pRTA-OA); also known as renal tubular acidosis II. Caused by an impairment of bicarbonate absorption in the proximal tubule, proximal renal tubular acidosis (pRTA) is characterized by a decreased renal HCO3(-) threshold. pRTA-OA is an extremely rare autosomal recessive syndrome characterized by short stature, profound pRTA, mental retardation, bilateral glaucoma, cataracts and bandkeratopathy. Loss of interaction with and stimulation by CA4 is the cause of retinitis pigmentosa type 17 (RP17). Belongs to the anion exchanger (TC 2.A.31) family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transporter, SLC family; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 4q21

Cellular Component: basolateral plasma membrane; integral to plasma membrane; plasma membrane

Molecular Function: protein binding; sodium:bicarbonate symporter activity

Biological Process: bicarbonate transport; regulation of intracellular pH; sodium ion transport; transport

Disease: Renal Tubular Acidosis, Proximal, With Ocular Abnormalities And Mental Retardation

Research Articles on SLC4A4

Similar Products

Product Notes

The SLC4A4 slc4a4 (Catalog #AAA1266443) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccactg aaaatgtgga agggaagccc agtaaccttg gggagagagg aagagcccgg agctccactt tcctcagggt tgtccagcca atgtttaacc acagtatttt cacttctgca gtctctcctg ctgcagaacg catccgattc atcttgggag aggaggatga cagcccagct ccccctcagc tcttcacgga actggatgag ctgctggccg tggatgggca ggagatggag tggaaggaaa cagccaggtg gatcaagttt gaagaaaaag tggaacaggg tggggaaaga tggagcaagc cccatgtggc cacattgtcc cttcatagtt tatttgagct gaggacatgt atggagaaag gatccatcat gcttgatcgg gaggcttctt ctctcccaca gttggtggag atgattgttg accatcagat tgagacaggc ctattgaaac ctgaacttaa ggataaggtg acctatactt tgctccggaa gcaccggcat caaaccaaga aatccaacct tcggtccctg gctgacattg ggaagacagt ctccagtgca agtaggatgt ttaccaaccc tgataatggt agcccagcca tgacccatag gaatctgact tcctccagtc tgaatgacat ttctgataaa ccggagaagg accagctgaa gaataagttc atgaaaaaat tgccacgtga tgcagaagct tccaacgtgc ttgttgggga ggttgacttt ttggatactc ctttcattgc ctttgttagg ctacagcagg ctgtcatgct gggtgccctg actgaagttc ctgtgcccac aaggttcttg ttcattctct taggtcctaa ggggaaagcc aagtcctacc acgagattgg cagagccatt gccaccctga tgtctgatga ggtgttccat gacattgctt ataaagcaaa agacaggcac gacctgattg ctggtattga tgagttccta gatgaagtca tcgtccttcc acctggggaa tgggatccag caattaggat agagcctcct aagagtcttc catcctctga caaaagaaag aatatgtact caggtggaga gaatgttcag atgaatgggg atacgcccca tgatggaggt cacggaggag gaggacatgg ggattgtgaa gaattgcagc gaactggacg gttctgtggt ggactaatta aagacataaa gaggaaagcg ccattttttg ccagtgattt ttatgatgct ttaaatattc aagctctttc ggcaattctc ttcatttatc tggcaactgt aactaatgct atcacttttg gaggactgct tggggatgcc actgacaaca tgcagggcgt gttggagagt ttcctgggca ctgctgtctc tggagccatc ttttgccttt ttgctggtca accactcact attctgagca gcaccggacc tgtcctagtt tttgagaggc ttctatttaa tttcagcaag gacaataatt ttgactattt ggagtttcgc ctttggattg gcctgtggtc cgccttccta tgtctcattt tggtagccac tgatgccagc ttcttggttc aatacttcac acgtttcacg gaggagggct tttcctctct gattagcttc atctttatct atgatgcttt caagaagatg atcaagcttg cagattacta ccccatcaac tccaacttca aagtgggcta caacactctc ttttcctgta cctgtgtgcc acctgaccca ggtgagggca ttacgctttg tgtttatgct cgctttgtat ttggaggaag gtgtaggctc catgcttgca aattttcaac atgctgtcat ggtcctcagg aattagtctt gtttttttct ctgaaaaact ctgctactga atttgatgtc tcattgcctg aggtatttta g. It is sometimes possible for the material contained within the vial of "SLC4A4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.