Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC3A2 cdna clone

SLC3A2 cDNA Clone

Gene Names
SLC3A2; 4F2; CD98; MDU1; 4F2HC; 4T2HC; NACAE; CD98HC
Synonyms
SLC3A2; SLC3A2 cDNA Clone; SLC3A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccaggacaccgaggtggatatgaaggaggtggagctgaatgagttagagcccgagaagcagccgatgaacgcggcgtctggggcggccatgtccctggcgggagccgagaagaatggtctggtgaagatcaaggtggcggaagacgaggcggaggcggcagccgcggctaagttcacgggcctgtccaaggaggagctgctgaaggtggcaggcagccccggctgggtacgcacccgctgggcactgctgctgctcttctggctcggctggctcggcatgcttgctggtgccgtggtcataatcgtgcgagcgccgcgttgtcgcgagctaccggcgcagaagtggtggcacacgggcgccctctaccgcatcggcgaccttcaggccttccagggccacggcgcgggcaacctggcgggtctgaaggggcgtctcgattacctgagctctctgaaggtgaagggccttgtgctgggtccaattcacaagaaccagaaggatgatgtcgctcagactgacttgctgcagatcgaccccaattttggctccaaggaagattttgacagtctcttgcaatcggctaaaaaaaagagcatccgtgtcattctggaccttactcccaactaccggggtgagaactcgtggttctccactcaggttgacactgtggccaccaaggtgaaggatgctctggagttttggctgcaagctggcgtggatgggttccaggttcgggacatagagaatctgaaggatgcatcctcattcttggctgagtggcaaaatatcaccaagggcttcagtgaagacaggctcttgattgcggggactaactcctccgaccttcagcagatcctgagcctactcgaatccaacaaagacttgctgttgactagctcatacctgtctgattctggttctactggggagcatacaaaatccctagtcacacagtatttgaatgccactggcaatcgctggtgcagctggagtttgtctcaggcaaggctcctgacttccttcttgccggctcaacttctccgactctaccagctgatgctcttcaccctgccagggacccctgttttcagctacggggatgagattggcctggatgcagctgcccttcctggacagcctatggaggctccagtcatgctgtgggatgagtccagcttccctgacatcccaggggctgtaagtgccaacatgactgtgaagggccagagtgaagaccctggctccctcctttccttgttccggcggctgagtgaccagcggagtaaggagcgctccctactgcatggggacttccacgcgttctccgctgggcctggactcttctcctatatccgccactgggaccagaatgagcgttttctggtagtgcttaactttggggatgtgggcctctcggctggactgcaggcctccgacctgcctgccagcgccagcctgccagccaaggctgacctcctgctcagcacccagccaggccgtgaggagggctcccctcttgagctggaacgcctgaaactggagcctcacgaagggctgctgctccgcttcccctacgcggcctga
Sequence Length
1590
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,123 Da
NCBI Official Full Name
Homo sapiens solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 3 member 2
NCBI Official Symbol
SLC3A2
NCBI Official Synonym Symbols
4F2; CD98; MDU1; 4F2HC; 4T2HC; NACAE; CD98HC
NCBI Protein Information
4F2 cell-surface antigen heavy chain
UniProt Protein Name
4F2 cell-surface antigen heavy chain
Protein Family
UniProt Gene Name
SLC3A2
UniProt Synonym Gene Names
MDU1; 4F2hc
UniProt Entry Name
4F2_HUMAN

NCBI Description

This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]

Uniprot Description

SLC3A2: a transmembrane solute carrier protein that transports L-type amino acids and regulates intracellular calcium levels. Involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. Involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. Plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. Required for normal and neoplastic cell growth. When associated with SLC7A5, is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta. Involved in the uptake of methylmercury (MeHg) when administered as the L-cysteine or D,L-homocysteine complexes, and hence plays a role in metal ion homeostasis and toxicity. When associated with SLC7A5 or SLC7A8, involved in the cellular activity of small molecular weight nitrosothiols, via the stereoselective transport of L- nitrosocysteine (L-CNSO) across the transmembrane. Together with ICAM1, regulates the transport activity LAT2 in polarized intestinal cells, by generating and delivering intracellular signals. When associated with SLC7A5, plays an important role in transporting L-leucine from the circulating blood to the retina across the inner blood-retinal barrier. Disulfide-linked heterodimer of a glycosylated heavy chain and a non-glycosylated light chain (SLC7A5, SLC7A6, SLCA7A7, SLC7A8, SLC7A10 or SLCA7A11). Colocalizes with cadherins. Interacts with FAM57A and ICAM1. Constitutively and specifically associates with beta-1 integrins (alpha-2/beta-1, alpha-3/beta-1, alpha-5/beta-1 and alpha-6/beta-1), but minimally with alpha-4/beta-1. Expression is induced in resting peripheral blood T- lymphocytes following PHA stimulation. Expression increases at the time of maximal DNA synthesi, in fibroblasts stimulated to divide. Expression and the uptake of leucine is stimulated in mononuclear, cytotrophoblast-like choriocarcinoma cells by combined treatment with PMA and calcium ionophore. Expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta was significantly stronger at full-term than at the mid- trimester stage. Belongs to the SLC3A transporter family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cell surface; cell-cell adherens junction; cytoplasm; membrane; nucleus; plasma membrane

Molecular Function: calcium:sodium antiporter activity; double-stranded RNA binding; neutral amino acid transmembrane transporter activity; protein binding

Biological Process: amino acid transport; leukocyte migration; response to exogenous dsRNA; tryptophan transport

Research Articles on SLC3A2

Similar Products

Product Notes

The SLC3A2 slc3a2 (Catalog #AAA1277432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagccagg acaccgaggt ggatatgaag gaggtggagc tgaatgagtt agagcccgag aagcagccga tgaacgcggc gtctggggcg gccatgtccc tggcgggagc cgagaagaat ggtctggtga agatcaaggt ggcggaagac gaggcggagg cggcagccgc ggctaagttc acgggcctgt ccaaggagga gctgctgaag gtggcaggca gccccggctg ggtacgcacc cgctgggcac tgctgctgct cttctggctc ggctggctcg gcatgcttgc tggtgccgtg gtcataatcg tgcgagcgcc gcgttgtcgc gagctaccgg cgcagaagtg gtggcacacg ggcgccctct accgcatcgg cgaccttcag gccttccagg gccacggcgc gggcaacctg gcgggtctga aggggcgtct cgattacctg agctctctga aggtgaaggg ccttgtgctg ggtccaattc acaagaacca gaaggatgat gtcgctcaga ctgacttgct gcagatcgac cccaattttg gctccaagga agattttgac agtctcttgc aatcggctaa aaaaaagagc atccgtgtca ttctggacct tactcccaac taccggggtg agaactcgtg gttctccact caggttgaca ctgtggccac caaggtgaag gatgctctgg agttttggct gcaagctggc gtggatgggt tccaggttcg ggacatagag aatctgaagg atgcatcctc attcttggct gagtggcaaa atatcaccaa gggcttcagt gaagacaggc tcttgattgc ggggactaac tcctccgacc ttcagcagat cctgagccta ctcgaatcca acaaagactt gctgttgact agctcatacc tgtctgattc tggttctact ggggagcata caaaatccct agtcacacag tatttgaatg ccactggcaa tcgctggtgc agctggagtt tgtctcaggc aaggctcctg acttccttct tgccggctca acttctccga ctctaccagc tgatgctctt caccctgcca gggacccctg ttttcagcta cggggatgag attggcctgg atgcagctgc ccttcctgga cagcctatgg aggctccagt catgctgtgg gatgagtcca gcttccctga catcccaggg gctgtaagtg ccaacatgac tgtgaagggc cagagtgaag accctggctc cctcctttcc ttgttccggc ggctgagtga ccagcggagt aaggagcgct ccctactgca tggggacttc cacgcgttct ccgctgggcc tggactcttc tcctatatcc gccactggga ccagaatgag cgttttctgg tagtgcttaa ctttggggat gtgggcctct cggctggact gcaggcctcc gacctgcctg ccagcgccag cctgccagcc aaggctgacc tcctgctcag cacccagcca ggccgtgagg agggctcccc tcttgagctg gaacgcctga aactggagcc tcacgaaggg ctgctgctcc gcttccccta cgcggcctga. It is sometimes possible for the material contained within the vial of "SLC3A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.