Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35A3 cdna clone

SLC35A3 cDNA Clone

Gene Names
SLC35A3; AMRS
Synonyms
SLC35A3; SLC35A3 cDNA Clone; SLC35A3 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcgccaacctaaaatacgtttccctgggaattttggtctttcagactaccagtttggttctaacaatgcgttattccagaactttaaaagaagaaggacctcgttatctatcttctacagcagtggttgttgctgaacttttgaagataatggcctgcattttattggtctacaaagacagcaaatgtagtctaagagcactgaatcgagtactacatgatgaaattcttaataaacctatggaaacacttaaacttgctattccatcagggatctatactcttcagaataatttactgtatgtggcactatcaaatctagatgcagctacttatcaggtcacgtatcagttgaaaattcttacaacagcattattttctgtgtctatgcttagtaaaaaattgggtgtataccagtggctgtccctagtaattttgatgacaggagttgcttttgtacagtggccctcagattctcagcttgattctaaggaactttcagctggttctcaatttgtaggactcatggcagttctcacagcatgtttttcaagtggctttgctggggtttactttgagaaaatcttaaaagaaacaaaacaatcagtgtggataagaaatattcagcttgtgtctttttccttggagccatccttgtaa
Sequence Length
663
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,545 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member A3
NCBI Official Symbol
SLC35A3
NCBI Official Synonym Symbols
AMRS
NCBI Protein Information
UDP-N-acetylglucosamine transporter
UniProt Protein Name
UDP-N-acetylglucosamine transporter
UniProt Gene Name
SLC35A3
UniProt Entry Name
S35A3_HUMAN

NCBI Description

This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Uniprot Description

SLC35A3: Uridine diphosphate-N-acetylglucosamine transporter in the Golgi apparatus. Belongs to the nucleotide-sugar transporter family. SLC35A subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Transporter; Transporter, SLC family

Chromosomal Location of Human Ortholog: 1p21

Cellular Component: Golgi apparatus; Golgi membrane

Molecular Function: protein binding; UDP-N-acetylglucosamine transmembrane transporter activity

Biological Process: UDP-N-acetylglucosamine metabolic process; UDP-N-acetylglucosamine transport

Disease: Arthrogryposis, Mental Retardation, And Seizures

Research Articles on SLC35A3

Similar Products

Product Notes

The SLC35A3 slc35a3 (Catalog #AAA1278644) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgcca acctaaaata cgtttccctg ggaattttgg tctttcagac taccagtttg gttctaacaa tgcgttattc cagaacttta aaagaagaag gacctcgtta tctatcttct acagcagtgg ttgttgctga acttttgaag ataatggcct gcattttatt ggtctacaaa gacagcaaat gtagtctaag agcactgaat cgagtactac atgatgaaat tcttaataaa cctatggaaa cacttaaact tgctattcca tcagggatct atactcttca gaataattta ctgtatgtgg cactatcaaa tctagatgca gctacttatc aggtcacgta tcagttgaaa attcttacaa cagcattatt ttctgtgtct atgcttagta aaaaattggg tgtataccag tggctgtccc tagtaatttt gatgacagga gttgcttttg tacagtggcc ctcagattct cagcttgatt ctaaggaact ttcagctggt tctcaatttg taggactcat ggcagttctc acagcatgtt tttcaagtgg ctttgctggg gtttactttg agaaaatctt aaaagaaaca aaacaatcag tgtggataag aaatattcag cttgtgtctt tttccttgga gccatccttg taa. It is sometimes possible for the material contained within the vial of "SLC35A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.