Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC2A5 cdna clone

SLC2A5 cDNA Clone

Gene Names
SLC2A5; GLUT5; GLUT-5
Synonyms
SLC2A5; SLC2A5 cDNA Clone; SLC2A5 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcaacaggatcagagcatgaaggaagggaggctgacgcttgtgcttgccctggcaaccctgatagctgcctttgggtcatccttccagtatgggtacaacgtggctgctgtcaactccccagcactgctcatgcaacaattttacaatgagacttactatggtaggaccggtgaattcatggaagacttccccttgacgttgctgtggtctgtaaccgtgtccatgtttccatttggagggtttatcggatccctcctggtcggccccttggtgaataaatttggcagaaaaggggccttgctgttcaacaacatattttctatcgtgcctgcgatcttaatgggatgcagcagagtcgccacatcatttgagcttatcattatttccagacttttggtgggaatatgtgcaggtgtatcttccaacgtggtccccatgtacttaggggagctggcccctaaaaacctgcggggggctctcggggtggtgccccagctcttcatcactgttggcatccttgtggcccagatctttggtcttcggaatctccttgcaaacgtagatggctggccgatcctgctggggctgaccggggtccccgcggcgctgcagctccttctgctgcccttcttccccgagagccccaggtacctgctgattcagaagaaagacgaagcggccgccaagaaagccctacagacgctgcgcggctgggactctgtggacagggaggtggccgagatccggcaggaggatgaggcagagaaggccgcgggcttcatctccgtgctgaagctgttccggatgcgctcgctgcgctggcagctgctgtccatcatcgtcctcatgggcggccagcagctgtcgggcgtcaacgctatctactactacgcggaccagatctacctgagcgccggcgtgccggaggagcacgtgcagtacgtgacggccggcaccggggccgtgaacgtggtcatgaccttctgcgccgtgttcgtggtggagctcctgggtcggaggctgctgctgctgctgggcttctccatctgcctcatagcctgctgcgtgctcactgcagctctggcactgcaggacacagtgtcctggatgccatacatcagcatcgtctgtgtcatctcctacgtcataggacatgccctcgggcccagtcccatacccgcgctgctcatcactgagatcttcctgcagtcctctcggccatctgccttcatggtggggggcagtgtgcactggctctccaacttcaccgtgggcttgatcttcccgttcatccaggagggcctcggcccgtacagcttcattgtcttcgccgtgatctgcctcctcaccaccatctacatcttcttgattgtcccggagaccaaggccaagacgttcatagagatcaaccagattttcaccaagatgaataaggtgtctgaagtgtacccggaaaaggaggaactgaaagagcttccacctgtcacttcggaacagtga
Sequence Length
1506
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,519 Da
NCBI Official Full Name
Homo sapiens solute carrier family 2 (facilitated glucose/fructose transporter), member 5, mRNA
NCBI Official Synonym Full Names
solute carrier family 2 member 5
NCBI Official Symbol
SLC2A5
NCBI Official Synonym Symbols
GLUT5; GLUT-5
NCBI Protein Information
solute carrier family 2, facilitated glucose transporter member 5
UniProt Protein Name
Solute carrier family 2, facilitated glucose transporter member 5
Protein Family
UniProt Gene Name
SLC2A5
UniProt Synonym Gene Names
GLUT5; GLUT-5
UniProt Entry Name
GTR5_HUMAN

NCBI Description

The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]

Uniprot Description

GLUT5: an integral membrane facilitative glucose transporter. One of 13 members of the human equilibrative glucose transport protein family. Plays an important role in fructose absorption by the intestine. Expressed primarily in the jejunal region of the small intestine. Expressed at low levels in human kidney, skeletal muscle, adipocytes, microglial cells and in the human blood-brain barrier.

Protein type: Transporter; Membrane protein, multi-pass; Membrane protein, integral; Transporter, SLC family

Chromosomal Location of Human Ortholog: 1p36.2

Cellular Component: apical plasma membrane; integral to plasma membrane; plasma membrane; sarcolemma

Molecular Function: fructose transmembrane transporter activity; glucose transmembrane transporter activity

Biological Process: carbohydrate metabolic process; fructose transport; glucose transport; hexose transport; regulation of systemic arterial blood pressure mediated by a chemical signal; response to fructose stimulus

Research Articles on SLC2A5

Similar Products

Product Notes

The SLC2A5 slc2a5 (Catalog #AAA1278510) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaac aggatcagag catgaaggaa gggaggctga cgcttgtgct tgccctggca accctgatag ctgcctttgg gtcatccttc cagtatgggt acaacgtggc tgctgtcaac tccccagcac tgctcatgca acaattttac aatgagactt actatggtag gaccggtgaa ttcatggaag acttcccctt gacgttgctg tggtctgtaa ccgtgtccat gtttccattt ggagggttta tcggatccct cctggtcggc cccttggtga ataaatttgg cagaaaaggg gccttgctgt tcaacaacat attttctatc gtgcctgcga tcttaatggg atgcagcaga gtcgccacat catttgagct tatcattatt tccagacttt tggtgggaat atgtgcaggt gtatcttcca acgtggtccc catgtactta ggggagctgg cccctaaaaa cctgcggggg gctctcgggg tggtgcccca gctcttcatc actgttggca tccttgtggc ccagatcttt ggtcttcgga atctccttgc aaacgtagat ggctggccga tcctgctggg gctgaccggg gtccccgcgg cgctgcagct ccttctgctg cccttcttcc ccgagagccc caggtacctg ctgattcaga agaaagacga agcggccgcc aagaaagccc tacagacgct gcgcggctgg gactctgtgg acagggaggt ggccgagatc cggcaggagg atgaggcaga gaaggccgcg ggcttcatct ccgtgctgaa gctgttccgg atgcgctcgc tgcgctggca gctgctgtcc atcatcgtcc tcatgggcgg ccagcagctg tcgggcgtca acgctatcta ctactacgcg gaccagatct acctgagcgc cggcgtgccg gaggagcacg tgcagtacgt gacggccggc accggggccg tgaacgtggt catgaccttc tgcgccgtgt tcgtggtgga gctcctgggt cggaggctgc tgctgctgct gggcttctcc atctgcctca tagcctgctg cgtgctcact gcagctctgg cactgcagga cacagtgtcc tggatgccat acatcagcat cgtctgtgtc atctcctacg tcataggaca tgccctcggg cccagtccca tacccgcgct gctcatcact gagatcttcc tgcagtcctc tcggccatct gccttcatgg tggggggcag tgtgcactgg ctctccaact tcaccgtggg cttgatcttc ccgttcatcc aggagggcct cggcccgtac agcttcattg tcttcgccgt gatctgcctc ctcaccacca tctacatctt cttgattgtc ccggagacca aggccaagac gttcatagag atcaaccaga ttttcaccaa gatgaataag gtgtctgaag tgtacccgga aaaggaggaa ctgaaagagc ttccacctgt cacttcggaa cagtga. It is sometimes possible for the material contained within the vial of "SLC2A5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.