Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC25A38 cdna clone

SLC25A38 cDNA Clone

Gene Names
SLC25A38; SIDBA2
Synonyms
SLC25A38; SLC25A38 cDNA Clone; SLC25A38 cdna clone
Ordering
For Research Use Only!
Sequence
atgattcagaactcacgtccgtcgctgctgcaaccccaagatgtcggagacacggtggaaacgcttatgttacatccggtgatcaaggctttcctgtgtggctccatcagtgggacctgctctaccctccttttccaacctctggatctccttaaaacacgcctacaaaccctccagccctcagatcatgggtctagacgtgttgggatgttggctgtactcttgaaggtggttcgcacggagagtcttttgggcctttggaaagggatgtccccttccattgtgagatgtgtccctggcgttggaatctactttggcactctctactctttgaagcagtatttcttgcgaggccatcccccaaccgccctggagtcagtcatgctgggggtgggctctcgctctgttgcaggggtctgtatgtcacctatcactgtaatcaagacgcgctatgagagtgggaaatatggctatgagagtatctacgctgccctgaggagcatctatcacagtgaggggcaccggggcctcttcagtggcctgacagcaactctccttcgagatgcgcccttctcaggaatctacctgatgttttacaaccagaccaaaaatatagtgcctcatgaccaggtggatgcaacccttattcctattacaaatttcagctgtgggatatttgctggtattctggcctcactggtaactcaacctgcggatgttatcaaaactcatatgcagctttatccactgaagtttcaatggattggccaagcagtgacacttattttcaaagactatggactacgtggcttcttccaaggtggcatcccccgagccctccgcagaactctaatggcagcaatggcgtggacggtgtatgaagagatgatggccaagatgggcctgaagtcctga
Sequence Length
915
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,566 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25, member 38, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 38
NCBI Official Symbol
SLC25A38
NCBI Official Synonym Symbols
SIDBA2
NCBI Protein Information
solute carrier family 25 member 38
UniProt Protein Name
Solute carrier family 25 member 38
Protein Family
UniProt Gene Name
SLC25A38
UniProt Entry Name
S2538_HUMAN

NCBI Description

This gene is a member of the mitochondrial carrier family. The encoded protein is required during erythropoiesis and is important for the biosynthesis of heme. Mutations in this gene are the cause of autosomal congenital sideroblastic anemia.[provided by RefSeq, Mar 2010]

Uniprot Description

SLC25A38: Mitochondrial carrier required during erythropoiesis. Probably involved in the biosynthesis of heme, possibly by facilitating 5-aminolevulinate (ALA) production. May act by importing glycine into mitochondria or by exchanging glycine for ALA across the mitochondrial inner membrane. Defects in SLC25A38 are a cause of anemia sideroblastic pyridoxine-refractory autosomal recessive (PRARSA). A form of sideroblastic anemia not responsive to pyridoxine. Sideroblastic anemia is characterized by anemia of varying severity, hypochromic peripheral erythrocytes, systemic iron overload secondary to chronic ineffective erythropoiesis, and the presence of bone marrow ringed sideroblasts. Sideroblasts are characterized by iron-loaded mitochondria clustered around the nucleus. Belongs to the mitochondrial carrier family. SLC25A38 subfamily.

Protein type: Mitochondrial; Transporter, SLC family; Membrane protein, multi-pass; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 3p22.1

Molecular Function: structural constituent of ribosome

Biological Process: erythrocyte differentiation; heme biosynthetic process; translation

Disease: Anemia, Sideroblastic, Pyridoxine-refractory, Autosomal Recessive

Research Articles on SLC25A38

Similar Products

Product Notes

The SLC25A38 slc25a38 (Catalog #AAA1267460) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcaga actcacgtcc gtcgctgctg caaccccaag atgtcggaga cacggtggaa acgcttatgt tacatccggt gatcaaggct ttcctgtgtg gctccatcag tgggacctgc tctaccctcc ttttccaacc tctggatctc cttaaaacac gcctacaaac cctccagccc tcagatcatg ggtctagacg tgttgggatg ttggctgtac tcttgaaggt ggttcgcacg gagagtcttt tgggcctttg gaaagggatg tccccttcca ttgtgagatg tgtccctggc gttggaatct actttggcac tctctactct ttgaagcagt atttcttgcg aggccatccc ccaaccgccc tggagtcagt catgctgggg gtgggctctc gctctgttgc aggggtctgt atgtcaccta tcactgtaat caagacgcgc tatgagagtg ggaaatatgg ctatgagagt atctacgctg ccctgaggag catctatcac agtgaggggc accggggcct cttcagtggc ctgacagcaa ctctccttcg agatgcgccc ttctcaggaa tctacctgat gttttacaac cagaccaaaa atatagtgcc tcatgaccag gtggatgcaa cccttattcc tattacaaat ttcagctgtg ggatatttgc tggtattctg gcctcactgg taactcaacc tgcggatgtt atcaaaactc atatgcagct ttatccactg aagtttcaat ggattggcca agcagtgaca cttattttca aagactatgg actacgtggc ttcttccaag gtggcatccc ccgagccctc cgcagaactc taatggcagc aatggcgtgg acggtgtatg aagagatgat ggccaagatg ggcctgaagt cctga. It is sometimes possible for the material contained within the vial of "SLC25A38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.