Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A16 cdna clone

SLC22A16 cDNA Clone

Gene Names
SLC22A16; CT2; OAT6; OCT6; OKB1; FLIPT2; HEL-S-18; dJ261K5.1
Synonyms
SLC22A16; SLC22A16 cDNA Clone; SLC22A16 cdna clone
Ordering
For Research Use Only!
Sequence
atggggtcccgccacttcgaggggatttatgaccacgtggggcacttcggcagattccagagagtcctctatttcatatgtgccttccagaacatctcttgtggtattcactacttggcttctgtgttcatgggagtcacccctcatcatgtctgcaggcccccaggcaatgtgagtcaggttgttttccataatcactctaattggagtttggaggacaccggggccctgttgtcttcaggccagaaagattatgttacggtgcagttgcagaatggtgagatctgggagctctcaaggtgtagcaggaataagagggagaacacatcgagtttgggctatgaatacactggcagtaagaaagagtttccttgtgtggatggctacatatatgaccagaacacatggaaaagcactgcggtgacccagtggaacctggtctgtgaccgaaaatggcttgcaatgctgatccagcccctatttatgtttggagtcctactgggatcggtgacttttggctacttttctgacaggctaggacgccgggtggtcttgtgggccacaagcagtagcatgtttttgtttggaatagcagcggcgtttgcagttgattattacaccttcatggctgctcgcttttttcttgccatggttgcaagtggctatcttgtggtggggtttgtctatgtgatggaattcattggcatgaagtctcggacatgggcgtctgtccatttgcattccttttttgcagttggaaccctgctggtggctttgacaggatacttggtcaggacctggtggctttaccagatgatcctctccacagtgactgtcccctttatcctgtgctgttgggtgctcccagagacacctttttggcttctctcagagggacgatatgaagaagcacaaaaaatagttgacatcatggccaagtggaacagggcaagctcctgtaaactgtcagaacttttatcactggacctacaaggtcctgttagtaatagccccactgaagttcagaagcacaacctatcatatctgttttataactggagcattacgaaaaggacacttaccgtttggctaatctggttcactggaagtttgggattctactcgttttccttgaattctgttaacttaggaggcaatgaatacttaaacctcttcctcctgggtgtagtggaaattcccgcctacaccttcgtgtgcatcgccatggacaaggtcgggaggagaacagtcctggcctactctcttttctgcagtgcactggcctgtggtgtcgttatggtgatcccccagaaacattatattttgggtgtggtgacagctatggttggaaaatttgccatcggggcagcatttggcctcatttatctttatacagctgagctgtatccaaccattgtaagatcgctggctgtgggaagcggcagcatggtgtgtcgcctggccagcatcctggcgccgttctctgtggacctcagcagcatttggatcttcataccacagttgtttgttgggactatggccctcctgagtggagtgttaacactaaagcttccagaaacccttgggaaacggctagcaactacttgggaggaggctgcaaaactggagtcagagaatgaaagcaagtcaagcaaattacttctcacaactaataatagtgggctggaaaaaacggaagcgattacccccagggattctggtcttggtgaataa
Sequence Length
1734
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,061 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22 (organic cation/carnitine transporter), member 16, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 16
NCBI Official Symbol
SLC22A16
NCBI Official Synonym Symbols
CT2; OAT6; OCT6; OKB1; FLIPT2; HEL-S-18; dJ261K5.1
NCBI Protein Information
solute carrier family 22 member 16
UniProt Protein Name
Solute carrier family 22 member 16
Protein Family
UniProt Gene Name
SLC22A16
UniProt Synonym Gene Names
OCT6; CT2; FLIPT2; Flipt 2
UniProt Entry Name
S22AG_HUMAN

NCBI Description

This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]

Uniprot Description

SLC22A16: High affinity carnitine transporter; the uptake is partially sodium-ion dependent. Thought to mediate the L-carnitine secretion mechanism from testis epididymal epithelium into the lumen which is involved in the maturation of spermatozoa. Also transports organic cations such as tetraethylammonium (TEA) and doxorubicin. The uptake of TEA is inhibited by various organic cations. The uptake of doxorubicin is sodium-independent. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Motility/polarity/chemotaxis; Transporter; Transporter, SLC family

Chromosomal Location of Human Ortholog: 6q22.1|6q21-q22.1

Cellular Component: integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: amine transmembrane transporter activity; carnitine transporter activity; organic cation transmembrane transporter activity

Biological Process: acid secretion; carnitine transport; organic cation transport; single fertilization; sperm motility

Research Articles on SLC22A16

Similar Products

Product Notes

The SLC22A16 slc22a16 (Catalog #AAA1267161) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggtccc gccacttcga ggggatttat gaccacgtgg ggcacttcgg cagattccag agagtcctct atttcatatg tgccttccag aacatctctt gtggtattca ctacttggct tctgtgttca tgggagtcac ccctcatcat gtctgcaggc ccccaggcaa tgtgagtcag gttgttttcc ataatcactc taattggagt ttggaggaca ccggggccct gttgtcttca ggccagaaag attatgttac ggtgcagttg cagaatggtg agatctggga gctctcaagg tgtagcagga ataagaggga gaacacatcg agtttgggct atgaatacac tggcagtaag aaagagtttc cttgtgtgga tggctacata tatgaccaga acacatggaa aagcactgcg gtgacccagt ggaacctggt ctgtgaccga aaatggcttg caatgctgat ccagccccta tttatgtttg gagtcctact gggatcggtg acttttggct acttttctga caggctagga cgccgggtgg tcttgtgggc cacaagcagt agcatgtttt tgtttggaat agcagcggcg tttgcagttg attattacac cttcatggct gctcgctttt ttcttgccat ggttgcaagt ggctatcttg tggtggggtt tgtctatgtg atggaattca ttggcatgaa gtctcggaca tgggcgtctg tccatttgca ttcctttttt gcagttggaa ccctgctggt ggctttgaca ggatacttgg tcaggacctg gtggctttac cagatgatcc tctccacagt gactgtcccc tttatcctgt gctgttgggt gctcccagag acaccttttt ggcttctctc agagggacga tatgaagaag cacaaaaaat agttgacatc atggccaagt ggaacagggc aagctcctgt aaactgtcag aacttttatc actggaccta caaggtcctg ttagtaatag ccccactgaa gttcagaagc acaacctatc atatctgttt tataactgga gcattacgaa aaggacactt accgtttggc taatctggtt cactggaagt ttgggattct actcgttttc cttgaattct gttaacttag gaggcaatga atacttaaac ctcttcctcc tgggtgtagt ggaaattccc gcctacacct tcgtgtgcat cgccatggac aaggtcggga ggagaacagt cctggcctac tctcttttct gcagtgcact ggcctgtggt gtcgttatgg tgatccccca gaaacattat attttgggtg tggtgacagc tatggttgga aaatttgcca tcggggcagc atttggcctc atttatcttt atacagctga gctgtatcca accattgtaa gatcgctggc tgtgggaagc ggcagcatgg tgtgtcgcct ggccagcatc ctggcgccgt tctctgtgga cctcagcagc atttggatct tcataccaca gttgtttgtt gggactatgg ccctcctgag tggagtgtta acactaaagc ttccagaaac ccttgggaaa cggctagcaa ctacttggga ggaggctgca aaactggagt cagagaatga aagcaagtca agcaaattac ttctcacaac taataatagt gggctggaaa aaacggaagc gattaccccc agggattctg gtcttggtga ataa. It is sometimes possible for the material contained within the vial of "SLC22A16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.